Source code for dandelion.base.preprocessing._preprocessing

import os
import json
import re
import shutil
import warnings

import anndata as ad
import numpy as np
import pandas as pd

from anndata import AnnData
from Bio import Align
from operator import countOf
from pathlib import Path
from plotnine import (
    ggplot,
    geom_bar,
    geom_col,
    ggtitle,
    scale_fill_manual,
    coord_flip,
    options,
    element_blank,
    aes,
    xlab,
    ylab,
    facet_grid,
    theme_classic,
    theme,
    save_as_pdf_pages,
)
from scanpy import logging as logg
from subprocess import run
from time import sleep
from tqdm import tqdm
from typing import Literal

from dandelion.external.immcantation.base.changeo import (
    assigngenes_igblast,
    makedb_igblast,
    parsedb_heavy,
    parsedb_light,
    creategermlines,
)
from dandelion.external.immcantation.tigger import tigger_genotype

from dandelion.base.core._core import (
    Dandelion,
    load_data,
    write_fasta,
    check_travdv,
)

from dandelion.base.io._io import (
    read_10x_vdj,
    write_airr,
    write_blastn,
)
from dandelion.utilities._utilities import (
    TRUES,
    FALSES,
    HEAVYLONG,
    LIGHTSHORT,
    NO_DS,
    DEFAULT_PREFIX,
    check_filepath,
    fasta_iterator,
    not_same_call,
    present,
    all_missing,
    sanitize_data,
    sanitize_column,
    lib_type,
    set_igblast_env,
    set_blast_env,
    check_data,
    Tree,
    _resolve_germline_vdj_dir,
    _load_germline_functionality_map,
    _lookup_gene_functionality,
)
from dandelion.base.tools._tools import transfer


[docs] def format_fasta( fasta: Path | str, prefix: str | None = None, suffix: str | None = None, sep: str | None = None, remove_trailing_hyphen_number: bool = True, high_confidence_filtering: bool = False, out_dir: Path | str | None = None, filename_prefix: str | None = None, ): """ Add prefix to the headers/contig ids in input fasta and annotation file. Parameters ---------- fasta : Path | str path to fasta file. prefix : str | None, optional prefix to append to the headers/contig ids. suffix : str | None, optional suffix to append to the headers/contig ids. sep : str | None, optional separator after prefix or before suffix to append to the headers/contig ids. remove_trailing_hyphen_number : bool, optional whether or not to remove the trailing hyphen number e.g. '-1' from the cell/contig barcodes. high_confidence_filtering : bool, optional whether ot not to filter to only `high confidence` contigs. out_dir : str | None, optional path to output location. `None` defaults to 'dandelion'. filename_prefix : str | None, optional prefix of file name preceding '_contig'. `None` defaults to 'all'. Raises ------ FileNotFoundError if path to fasta file is unknown. """ filename_pre = ( DEFAULT_PREFIX if filename_prefix is None else filename_prefix ) file_path = check_filepath( fasta, filename_prefix=filename_pre, ends_with=".fasta", within_dandelion=False, ) if file_path is None: raise FileNotFoundError( "Path to fasta file is unknown. Please " + "specify path to fasta file or folder containing fasta file. " + "Starting folder should only contain 1 fasta file." ) # before continuing, check if the file is not empty if os.stat(file_path).st_size == 0: raise ValueError( f"{str(file_path)} is empty. Please check the file and try again or remove if necessary." ) fh = open(file_path) seqs = {} if sep is None: separator = "_" else: separator = str(sep) for header, sequence in fasta_iterator(fh): if prefix is None and suffix is None: seqs[header] = sequence elif prefix is not None: if suffix is not None: if remove_trailing_hyphen_number: newheader = ( str(prefix) + separator + str(header).split("_contig")[0].split("-")[0] + separator + str(suffix) + "_contig" + str(header).split("_contig")[1] ) else: newheader = ( str(prefix) + separator + str(header).split("_contig")[0] + separator + str(suffix) + "_contig" + str(header).split("_contig")[1] ) else: if remove_trailing_hyphen_number: newheader = ( str(prefix) + separator + str(header).split("_contig")[0].split("-")[0] + "_contig" + str(header).split("_contig")[1] ) else: newheader = str(prefix) + separator + str(header) seqs[newheader] = sequence else: if suffix is not None: if remove_trailing_hyphen_number: newheader = ( str(header).split("_contig")[0].split("-")[0] + separator + str(suffix) + "_contig" + str(header).split("_contig")[1] ) else: newheader = ( str(header).split("_contig")[0] + separator + str(suffix) + "_contig" + str(header).split("_contig")[1] ) else: newheader = str(header) seqs[newheader] = sequence fh.close() base_dir = file_path.parent if file_path.is_file() else Path.cwd() out_dir = base_dir / "dandelion" if out_dir is None else Path(out_dir) out_dir.mkdir(parents=True, exist_ok=True) # format the barcode and contig_id in the corresponding annotation file too anno = check_filepath( fasta, filename_prefix=filename_pre, ends_with="_annotations.csv", within_dandelion=False, ) data = pd.read_csv(anno, dtype="object") if prefix is not None: if suffix is not None: if remove_trailing_hyphen_number: data["contig_id"] = [ str(prefix) + separator + str(c).split("_contig")[0].split("-")[0] + separator + str(suffix) + "_contig" + str(c).split("_contig")[1] for c in data["contig_id"] ] data["barcode"] = [ str(prefix) + separator + str(b).split("-")[0] + separator + str(suffix) for b in data["barcode"] ] else: data["contig_id"] = [ str(prefix) + separator + str(c).split("_contig")[0] + separator + str(suffix) + "_contig" + str(c).split("_contig")[1] for c in data["contig_id"] ] data["barcode"] = [ str(prefix) + separator + str(b) + separator + str(suffix) for b in data["barcode"] ] else: if remove_trailing_hyphen_number: data["contig_id"] = [ str(prefix) + separator + str(c).split("_contig")[0].split("-")[0] + "_contig" + str(c).split("_contig")[1] for c in data["contig_id"] ] data["barcode"] = [ str(prefix) + separator + str(b).split("-")[0] for b in data["barcode"] ] else: data["contig_id"] = [ str(prefix) + separator + str(c) for c in data["contig_id"] ] data["barcode"] = [ str(prefix) + separator + str(b) for b in data["barcode"] ] else: if suffix is not None: if remove_trailing_hyphen_number: data["contig_id"] = [ str(c).split("_contig")[0].split("-")[0] + separator + str(suffix) + "_contig" + str(c).split("_contig")[1] for c in data["contig_id"] ] data["barcode"] = [ str(b).split("-")[0] + separator + str(suffix) for b in data["barcode"] ] else: data["contig_id"] = [ str(c).split("_contig")[0] + separator + str(suffix) + "_contig" + str(c).split("_contig")[1] for c in data["contig_id"] ] data["barcode"] = [ str(b) + separator + str(suffix) for b in data["barcode"] ] else: data["contig_id"] = [str(c) for c in data["contig_id"]] data["barcode"] = [str(b) for b in data["barcode"]] anno = check_filepath( fasta, filename_prefix=filename_pre, ends_with="_annotations.csv", within_dandelion=False, ) out_anno = out_dir / (file_path.stem + "_annotations.csv") out_fasta = out_dir / file_path.name fh1 = open(out_fasta, "w") fh1.close() if high_confidence_filtering: hiconf_contigs = [ x for x, y in zip(data["contig_id"], data["high_confidence"]) if y in TRUES ] seqs = {hiconf: seqs[hiconf] for hiconf in hiconf_contigs} data = data[data["contig_id"].isin(hiconf_contigs)] write_fasta(fasta_dict=seqs, out_fasta=out_fasta) data.to_csv(out_anno, index=False)
[docs] def format_fastas( fastas: list[Path | str] | Path | str, prefix: list[str] | None = None, suffix: list[str] | None = None, sep: str | None = None, remove_trailing_hyphen_number: bool = True, high_confidence_filtering: bool = False, out_dir: Path | str | None = None, filename_prefix: list[str] | str | None = None, ): """ Add prefix to the headers/contig ids in input fasta and annotation file. Parameters ---------- fastas : list[Path | str] list of paths to fasta files. prefix : list[str] | None, optional list of prefixes to append to headers/contig ids in each fasta file. suffix : list[str] | None, optional list of suffixes to append to headers/contig ids in each fasta file. sep : str | None, optional separator after prefix or before suffix to append to the headers/contig ids. remove_trailing_hyphen_number : bool, optional whether or not to remove the trailing hyphen number e.g. '-1' from the cell/contig barcodes. high_confidence_filtering : bool, optional whether ot not to filter to only `high confidence` contigs. out_dir : Path | str | None, optional path to out put location. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. `None` defaults to 'all'. """ fastas, filename_prefix = check_data(fastas, filename_prefix) if prefix is not None: if not isinstance(prefix, list): prefix = [prefix] prefix_dict = dict(zip(fastas, prefix)) if suffix is not None: if not isinstance(suffix, list): suffix = [suffix] suffix_dict = dict(zip(fastas, suffix)) for i in tqdm( range(0, len(fastas)), desc="Formatting fasta(s) ", bar_format="{l_bar}{bar:10}{r_bar}{bar:-10b}", ): if prefix is None and suffix is None: format_fasta( fastas[i], prefix=None, suffix=None, sep=None, remove_trailing_hyphen_number=remove_trailing_hyphen_number, high_confidence_filtering=high_confidence_filtering, out_dir=out_dir, filename_prefix=filename_prefix[i], ) elif prefix is not None: if suffix is not None: format_fasta( fastas[i], prefix=prefix_dict[fastas[i]], suffix=suffix_dict[fastas[i]], sep=sep, remove_trailing_hyphen_number=remove_trailing_hyphen_number, high_confidence_filtering=high_confidence_filtering, out_dir=out_dir, filename_prefix=filename_prefix[i], ) else: format_fasta( fastas[i], prefix=prefix_dict[fastas[i]], suffix=None, sep=sep, remove_trailing_hyphen_number=remove_trailing_hyphen_number, high_confidence_filtering=high_confidence_filtering, out_dir=out_dir, filename_prefix=filename_prefix[i], ) else: if suffix is not None: format_fasta( fastas[i], prefix=None, suffix=suffix_dict[fastas[i]], sep=sep, remove_trailing_hyphen_number=remove_trailing_hyphen_number, high_confidence_filtering=high_confidence_filtering, out_dir=out_dir, filename_prefix=filename_prefix[i], ) else: format_fasta( fastas[i], prefix=None, suffix=None, sep=None, remove_trailing_hyphen_number=remove_trailing_hyphen_number, high_confidence_filtering=high_confidence_filtering, out_dir=out_dir, filename_prefix=filename_prefix[i], )
[docs] def assign_isotype( fasta: Path | str, org: Literal["human", "mouse"] = "human", evalue: float = 1e-4, correct_c_call: bool = True, correction_dict: dict[str, dict[str, str]] | None = None, plot: bool = True, save_plot: bool = False, show_plot: bool = True, figsize: tuple[float, float] = (4, 4), blastdb: Path | str | None = None, filename_prefix: str | None = None, additional_args: list[str] = [], ): """ Annotate contigs with constant region call using blastn. Parameters ---------- fasta : Path | str path to fasta file. org : Literal["human", "mouse"], optional organism of reference folder. evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. correct_c_call : bool, optional whether or not to adjust the c_calls after blast based on provided primers specified in `primer_dict` option. correction_dict : dict[str, dict[str, str]] | None, optional a nested dictionary contain isotype/c_genes as keys and primer sequences as records to use for correcting annotated c_calls. Defaults to a curated dictionary for human sequences if left as none. plot : bool, optional whether or not to plot reassignment summary metrics. save_plot : bool, optional whether or not to save plot. show_plot : bool, optional whether or not to show plot. figsize : tuple[float, float], optional size of figure. blastdb : Path | str | None, optional path to blast database. Defaults to `$BLASTDB` environmental variable. filename_prefix : str | None, optional prefix of file name preceding '_contig'. `None` defaults to 'all'. additional_args : list[str], optional additional arguments to pass to `blastn`. Raises ------ FileNotFoundError if path to fasta file is unknown. """ aligner = Align.PairwiseAligner() def gene_correction(df: pd.DataFrame, i: str, dictionary: dict[str, str]): """Generalized pairwise alignment for multiple genes.""" seq = df.loc[i, "c_sequence_alignment"].replace("-", "") scores = { key: aligner.align(seq, dictionary[key]).score for key in dictionary } max_score = max(scores.values()) df.at[i, "c_call"] = ",".join( key for key, score in scores.items() if score == max_score ) def _correct_c_call( data: pd.DataFrame, org: Literal["human", "mouse"] = "human", primers_dict: dict[str, dict[str, str]] | None = None, ) -> pd.DataFrame: """Pairwise alignment for c genes. Parameters ---------- data : pd.DataFrame Input data Frame. primers_dict : dict[str, dict[str, str]] | None, optional Gene:Sequence dictionary to do pairwise alignment with. Returns ------- pd.DataFrame Output data frame with c_call adjusted. """ dat = data.copy() if primers_dict is None: if org == "human": primer_dict = { "IGHG": { "IGHG1": "GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGC", "IGHG2": "GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCGGCCCTGGGC", "IGHG3": "GCTTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCTGGGGGCACAGCGGCCCTGGGC", "IGHG4": "GCTTCCACCAAGGGCCCATCCGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCCGCCCTGGGC", }, "IGHA": { "IGHA1": "GCATCCCCGACCAGCCCCAAGGTCTTCCCGCTGAGCCTCTGCAGCACCCAGCCAGATGGGAACGTGGTCATCGCCTGC", "IGHA2": "GCATCCCCGACCAGCCCCAAGGTCTTCCCGCTGAGCCTCGACAGCACCCCCCAAGATGGGAACGTGGTCGTCGCATGC", }, "IGLC7": { "IGLC": "GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTG" "TGTCTCATAA", "IGLC7": "GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCACCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGT" "GTGTCTCGTAA", }, "IGLC3": { "IGLC": "GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTG" "TGTCTCATAA", "IGLC3": "GTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCACCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGT" "GTGTCTCATAA", }, "IGLC6": { "IGLC": "TCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGTCTCA", "IGLC6": "TCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAGCTTCAAGCCAACAAGGCCACACTGGTGTGCCTGA", }, } else: primer_dict = { "IGHG2": { "IGHG2A": "GCCAAAACAACAGCCCCATCGGTCTATCCACTGGCCCCTGTGTGTGGAGATACAACTGGC", "IGHG2B": "GCCAAAACAACACCCCCATCAGTCTATCCACTGGCCCCTGGGTGTGGAGATACAACTGGT", "IGHG2C": "GCCAAAACAACAGCCCCATCGGTCTATCCACTGGCCCCTGTGTGTGGAGGTACAACTGGC", } } else: primer_dict = primers_dict for i in dat.index: if pd.notnull(dat.loc[i, "c_call"]): for k, genes in primer_dict.items(): if k in dat.loc[i, "c_call"]: if "IGHG4A" not in dat.loc[i, "c_call"]: gene_correction(dat, i, genes) return dat filePath = check_filepath( fasta, filename_prefix=filename_prefix, ends_with=".fasta" ) if filePath is None: raise FileNotFoundError( "Path to fasta file is unknown. Please specify path to " + "fasta file or folder containing fasta file." ) blast_out = run_blastn( fasta=filePath, database=blastdb, org=org, loci="ig", call="c", max_hsps=1, evalue=evalue, outfmt=( "6 qseqid sseqid pident length mismatch gapopen " + "qstart qend sstart send evalue bitscore qseq sseq" ), dust="no", additional_args=additional_args, ) blast_out.drop_duplicates(subset="sequence_id", keep="first", inplace=True) _10xfile = check_filepath( fasta, filename_prefix=filename_prefix, ends_with="_annotations.csv", ) _airrfile = check_filepath( fasta, filename_prefix=filename_prefix, ends_with="_igblast.tsv", sub_dir="tmp", ) _processedfile = check_filepath( fasta, filename_prefix=filename_prefix, ends_with="_igblast_db-pass_genotyped.tsv", sub_dir="tmp", ) if _processedfile is None: _processedfile = check_filepath( fasta, filename_prefix=filename_prefix, ends_with="_igblast_db-pass.tsv", sub_dir="tmp", ) out_ex = "_igblast_db-pass.tsv" else: out_ex = "_igblast_db-pass_genotyped.tsv" dat = load_data(_processedfile) if _10xfile is not None: dat_10x = read_10x_vdj(_10xfile) res_10x = pd.DataFrame(dat_10x._data["c_call"].replace("", "None")) else: # pragma: no cover res_10x = pd.DataFrame(dat["c_call"]) res_10x["c_call"] = "None" for col in [ "c_call", "c_sequence_alignment", "c_germline_alignment", "c_sequence_start", "c_sequence_end", "c_score", "c_identity", ]: dat[col] = pd.Series(blast_out[col]) res_blast = pd.DataFrame(dat["c_call"].replace("", "None")) res_blast = res_blast.fillna(value="None") res_10x_sum = pd.DataFrame( res_10x["c_call"].value_counts(normalize=True) * 100 ) res_10x_sum["group"] = "10X" res_10x_sum.columns = ["counts", "group"] res_10x_sum.index = res_10x_sum.index.set_names(["c_call"]) res_10x_sum.reset_index(drop=False, inplace=True) res_blast_sum = pd.DataFrame( res_blast["c_call"].value_counts(normalize=True) * 100 ) res_blast_sum["group"] = "blast" res_blast_sum.columns = ["counts", "group"] res_blast_sum.index = res_blast_sum.index.set_names(["c_call"]) res_blast_sum.reset_index(drop=False, inplace=True) if ( correct_c_call ): # TODO: figure out if i need to set up a None correction? dat = _correct_c_call(dat, primers_dict=correction_dict, org=org) res_corrected = pd.DataFrame(dat["c_call"].replace("", "None")) res_corrected = res_corrected.fillna(value="None") res_corrected_sum = pd.DataFrame( res_corrected["c_call"].value_counts(normalize=True) * 100 ) res_corrected_sum["group"] = "corrected" res_corrected_sum.columns = ["counts", "group"] res_corrected_sum.index = res_corrected_sum.index.set_names(["c_call"]) res_corrected_sum.reset_index(drop=False, inplace=True) res = pd.concat([res_10x_sum, res_blast_sum, res_corrected_sum]) else: # pragma: no cover res = pd.concat([res_10x_sum, res_blast_sum]) res = res.reset_index(drop=True) res["c_call"] = res["c_call"].fillna(value="None") res["c_call"] = [re.sub("[*][0-9][0-9]", "", c) for c in res["c_call"]] res["c_call"] = res["c_call"].astype("category") res["c_call"] = res["c_call"].cat.reorder_categories( sorted(list(set(res["c_call"])), reverse=True) ) dat["c_call_10x"] = pd.Series(res_10x["c_call"]) # some minor adjustment to the final output table airr_output = load_data(_airrfile) cols_to_merge = [ "junction_aa_length", "fwr1_aa", "fwr2_aa", "fwr3_aa", "fwr4_aa", "cdr1_aa", "cdr2_aa", "cdr3_aa", "sequence_alignment_aa", "v_sequence_alignment_aa", "d_sequence_alignment_aa", "j_sequence_alignment_aa", ] for x in cols_to_merge: dat[x] = pd.Series(airr_output[x]) # remove allellic calls dat["c_call"] = dat["c_call"].fillna(value="") dat["c_call"] = [re.sub("[*][0-9][0-9]", "", c) for c in dat["c_call"]] write_airr(dat, _processedfile) if plot: options.figure_size = figsize if correct_c_call: p = ( ggplot(res, aes(x="c_call", y="counts", fill="group")) + coord_flip() + theme_classic() + xlab("c_call") + ylab("% c calls") + geom_col(stat="identity", position="dodge") + scale_fill_manual(values=("#79706e", "#86bcb6", "#F28e2b")) + theme(legend_title=element_blank()) ) else: p = ( ggplot(res, aes(x="c_call", y="counts", fill="group")) + coord_flip() + theme_classic() + xlab("c_call") + ylab("% c calls") + geom_col(stat="identity", position="dodge") + scale_fill_manual(values=("#79706e", "#86bcb6")) + theme(legend_title=element_blank()) ) if save_plot: _file3 = filePath.parent / "assign_isotype.pdf" save_as_pdf_pages([p], filename=_file3, verbose=False) if show_plot: # pragma: no cover p.show() # move and rename move_to_tmp(fasta, filename_prefix) make_all(fasta, filename_prefix, loci="ig") rename_dandelion(fasta, filename_prefix, ends_with=out_ex, sub_dir="tmp") update_j_multimap(fasta, filename_prefix)
[docs] def assign_isotypes( fastas: list[Path | str] | Path | str, org: Literal["human", "mouse"] = "human", evalue: float = 1e4, correct_c_call: bool = True, correction_dict: dict[str, dict[str, str]] | None = None, plot: bool = True, save_plot: bool = False, show_plot: bool = True, figsize: tuple[float, float] = (4, 4), blastdb: Path | str | None = None, filename_prefix: list[str] | str | None = None, additional_args: list[str] = [], ): """ Annotate contigs with constant region call using blastn. Parameters ---------- fastas : list[Path | str] | Path | str path(s) to fasta file(s). org : Literal["human", "mouse"], optional organism of reference folder. evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. correct_c_call : bool, optional whether or not to adjust the c_calls after blast based on provided primers specified in `primer_dict` option. correction_dict : dict[str, dict[str, str]] | None, optional a nested dictionary contain isotype/c_genes as keys and primer sequences as records to use for correcting annotated c_calls. Defaults to a curated dictionary for human sequences if left as none. plot : bool, optional whether or not to plot reassignment summary metrics. save_plot : bool, optional whether or not to save plots. show_plot : bool, optional whether or not to show plots. figsize : tuple[float, float], optional size of figure. blastdb : Path | str | None, optional path to blast database. Defaults to `$BLASTDB` environmental variable. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. `None` defaults to 'all'. additional_args : list[str], optional additional arguments to pass to `blastn`. """ fastas, filename_prefix = check_data(fastas, filename_prefix) logg.info("Assign isotypes \n") for i in range(0, len(fastas)): assign_isotype( fastas[i], org=org, evalue=evalue, correct_c_call=correct_c_call, correction_dict=correction_dict, plot=plot, save_plot=save_plot, show_plot=show_plot, figsize=figsize, blastdb=blastdb, filename_prefix=filename_prefix[i], additional_args=additional_args, )
[docs] def reannotate_genes( data: list[Path | str] | Path | str, igblast_db: str | None = None, germline: str | None = None, org: Literal["human", "mouse"] = "human", loci: Literal["ig", "tr"] = "ig", extended: bool = True, filename_prefix: list[str] | str | None = None, flavour: Literal["strict", "original"] = "strict", min_j_match: int = 7, min_d_match: int = 9, v_evalue: float = 1e-4, d_evalue: float = 1e-3, j_evalue: float = 1e-4, reassign_dj: bool = True, overwrite: bool = True, dust: str | None = "no", db: Literal["imgt", "ogrdb", "kiarva", "gkhlab"] = "imgt", lightchain_db: Literal["imgt", "ogrdb"] | None = None, strain: ( Literal[ "c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J", ] | None ) = None, additional_args: dict[str, list[str]] = { "assigngenes": [], "makedb": [], "igblastn": [], "blastn_j": [], "blastn_d": [], }, ): """ Reannotate cellranger fasta files with igblastn and parses to airr format. Parameters ---------- data : list[str] list of fasta file locations, or folder name containing fasta files. if provided as a single string, it will first be converted to a list; this allows for the function to be run on single/multiple samples. igblast_db : str | None, optional path to igblast database folder. Defaults to `IGDATA` environmental variable. germline : str | None, optional path to germline database folder. Defaults to `GERMLINE` environmental variable. org : Literal["human", "mouse"], optional organism of germline database. loci : Literal["ig", "tr"], optional mode for igblastn. 'ig' for BCRs, 'tr' for TCRs. extended : bool, optional whether or not to transfer additional 10X annotations to output file. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. `None` defaults to 'all'. flavour : Literal["strict", "original"], optional Either 'strict' or 'original'. Determines how igblastn should be run. Running in 'strict' flavour will add the additional the evalue and min_d_match options to the run. min_j_match : int, optional Minimum D gene nucleotide matches. This controls the threshold for D gene detection. You can set the minimal number of required consecutive nucleotide matches between the query sequence and the D genes based on your own criteria. Note that the matches do not include overlapping matches at V-D or D-J junctions. min_d_match : int, optional Minimum D gene nucleotide matches. This controls the threshold for D gene detection. You can set the minimal number of required consecutive nucleotide matches between the query sequence and the D genes based on your own criteria. Note that the matches do not include overlapping matches at V-D or D-J junctions. v_evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. for v gene. d_evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. for d gene. j_evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. for j gene. reassign_dj : bool, optional whether or not to perform a targetted blastn reassignment for D and J genes. overwrite : bool, optional whether or not to overwrite the assignment if flavour = 'strict'. dust : str | None, optional dustmasker options. Filter query sequence with DUST Format: 'yes', or 'no' to disable. Accepts str. If None, defaults to `20 64 1`. db : Literal["imgt", "ogrdb", "kiarva", "gkhlab"], optional database to use for igblastn. Defaults to 'imgt'. lightchain_db : Literal["imgt", "ogrdb"] | None, optional database to use for light chain annotation. None defaults to `db`. However, if `db` is 'kiarva', `None` defaults to 'imgt' but this option can also be set to 'ogrdb' if desired. strain : Literal["c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J"] | None, optional strain of mouse to use for germline sequences. Only for `db="ogrdb"`. Note that only "c57bl6", "balbc", "CAST_EiJ", "LEWES_EiJ", "MSM_MsJ", "NOD_ShiLt_J" and "PWD_PhJ" contains both heavy chain and light chain germline sequences as a set. The rest will not allow igblastn and MakeDB.py to generate a successful airr table (check the failed file). "c57bl6" and "balbc" are merged databases of "C57BL_6" with "C57BL_6J" and "BALB_c" with "BALB_c_ByJ" respectively. None defaults to all combined. additional_args : dict[str, list[str]], optional additional arguments to pass to `AssignGenes.py`, `MakeDb.py`, `igblastn` and `blastn`. This accepts a dictionary with keys as the name of the sub-function (`assigngenes`, `makedb`, `igblastn`, `blastn_j` and `blastn_d`) and the records as lists of arguments to pass to the relevant scripts/tools. Raises ------ FileNotFoundError if path to fasta file is unknown. """ data, filename_prefix = check_data(data, filename_prefix) filePath = None for i in tqdm( range(0, len(data)), desc="Assigning genes ", bar_format="{l_bar}{bar:10}{r_bar}{bar:-10b}", ): filePath = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with=".fasta" ) if filePath is None: if filename_prefix[i] is not None: raise FileNotFoundError( "Path to fasta file with filename prefix `{}_contig` is unknown. ".format( filename_prefix[i] ) + "Please specify path to fasta file or folder containing fasta file." ) else: raise FileNotFoundError( "Path to fasta file is unknown. " + "Please specify path to fasta file or folder containing fasta file." ) logg.info(f"Processing {str(filePath)} \n") if db == "kiarva": db = ( "kiarva_imgt" if lightchain_db is None else f"kiarva_{lightchain_db}" ) if flavour == "original": assigngenes_igblast( filePath, igblast_db=igblast_db, org=org, loci=loci, additional_args=additional_args["assigngenes"], ) elif flavour == "strict": run_igblastn( filePath, igblast_db=igblast_db, org=org, loci=loci, evalue=v_evalue, min_d_match=min_d_match, db=db, strain=strain, additional_args=additional_args["igblastn"], ) db = "imgt" if flavour == "original" else db makedb_igblast( filePath, org=org, germline=germline, extended=extended, db=db, additional_args=additional_args["makedb"], loci=loci, ) # block this for now, until I figure out if it's # worth it if flavour == "strict": if reassign_dj: assign_DJ( fasta=filePath, org=org, loci=loci, call="j", database=igblast_db, evalue=j_evalue, filename_prefix=filename_prefix, dust=dust, word_size=min_j_match, overwrite=overwrite, db=db, strain=strain, additional_args=additional_args["blastn_j"], ) assign_DJ( fasta=filePath, org=org, loci=loci, call="d", database=igblast_db, evalue=d_evalue, filename_prefix=filename_prefix, dust=dust, word_size=min_d_match, overwrite=overwrite, db=db, strain=strain, additional_args=additional_args["blastn_d"], ) ensure_columns_transferred( fasta=filePath, filename_prefix=filename_prefix, ) if loci == "tr": change_file_location(data, filename_prefix) if flavour == "strict": mask_dj(data, filename_prefix, d_evalue, j_evalue) move_to_tmp(data, filename_prefix) make_all(data, filename_prefix, loci=loci) rename_dandelion( data, filename_prefix, ends_with="_igblast_db-pass.tsv" ) update_j_multimap(data, filename_prefix)
def return_pass_fail_filepaths( fasta: Path | str, filename_prefix: str | None = None, ) -> tuple[Path, Path, Path]: """Return necessary file paths for internal use only. Parameters ---------- fasta : Path | str path to fasta file. filename_prefix : str | None, optional prefix of file name preceding '_contig'. `None` defaults to 'all'. Returns ------- tuple[Path, Path, Path] file paths for downstream functions. Raises ------ FileNotFoundError if path to fasta file is unknown. """ file_path = check_filepath( fasta, filename_prefix=filename_prefix, ends_with=".fasta" ) if file_path is None: raise FileNotFoundError( "Path to fasta file is unknown. Please specify " + "path to fasta file or folder containing fasta file." ) # read the original object pass_path = ( file_path.parent / "tmp" / (file_path.stem + "_igblast_db-pass.tsv") ) fail_path = ( file_path.parent / "tmp" / (file_path.stem + "_igblast_db-fail.tsv") ) return file_path, pass_path, fail_path def ensure_columns_transferred( fasta: str, filename_prefix: str | None = None, ): """Ensure the additional columns are successfully populated. Parameters ---------- fasta : str path to fasta file. filename_prefix : str | None, optional prefix of file name preceding '_contig'. `None` defaults to 'all'. """ filePath, passfile, failfile = return_pass_fail_filepaths( fasta, filename_prefix=filename_prefix ) addcols = [ "_support_igblastn", "_score_igblastn", "_call_igblastn", "_call_blastn", "_identity_blastn", "_alignment_length_blastn", "_number_of_mismatches_blastn", "_number_of_gap_openings_blastn", "_sequence_start_blastn", "_sequence_end_blastn", "_germline_start_blastn", "_germline_end_blastn", "_support_blastn", "_score_blastn", "_sequence_alignment_blastn", "_germline_alignment_blastn", "_source", ] if passfile.is_file(): db_pass = load_data(passfile) else: db_pass = None if failfile.is_file(): db_fail = load_data(failfile) else: db_fail = None # load the 10x file _10xfile = check_filepath( fasta.parent / (fasta.stem + "_annotations.csv"), filename_prefix=filename_prefix, ends_with="_annotations.csv", ) if _10xfile is not None: dat_10x = read_10x_vdj(_10xfile) else: dat_10x = None if db_pass is not None: for call in ["d", "j"]: for col in addcols: add_col = call + col if add_col not in db_pass: db_pass[add_col] = "" if dat_10x is not None: for col in ["consensus_count", "umi_count"]: if all_missing(db_pass[col]): db_pass[col] = pd.Series(dat_10x._data[col]) db_pass = sanitize_data(db_pass) db_pass.to_csv(passfile, sep="\t", index=False) if db_fail is not None: for call in ["d", "j"]: for col in addcols: add_col = call + col if add_col not in db_fail: db_fail[add_col] = "" if dat_10x is not None: for col in ["consensus_count", "umi_count"]: if all_missing(db_fail[col]): db_fail[col] = pd.Series(dat_10x._data[col]) db_fail = sanitize_data(db_fail) db_fail.to_csv(failfile, sep="\t", index=False)
[docs] def reassign_alleles( data: list[str], combined_folder: str, v_germline: str | None = None, germline: str | None = None, org: Literal["human", "mouse"] = "human", db: Literal["imgt", "ogrdb", "kiarva"] = "imgt", lightchain_db: Literal["imgt", "ogrdb"] | None = None, strain: ( Literal[ "c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J", ] | None ) = None, novel: bool = True, plot: bool = True, save_plot: bool = False, show_plot: bool = True, figsize: tuple[float, float] = (4, 3), sample_id_dictionary: dict[str, str] | None = None, filename_prefix: list[str] | str | None = None, additional_args: dict[str, list[str]] = { "tigger": [], "creategermlines": [], }, ): """ Correct allele calls based on a personalized genotype using tigger. It uses a subject-specific genotype to correct correct preliminary allele assignments of a set of sequences derived from a single subject. Parameters ---------- data : list[str] list of data folders containing the .tsv files. if provided as a single string, it will first be converted to a list; this allows for the function to be run on single/multiple samples. combined_folder : str name of folder for concatenated data file and genotyped files. v_germline : str | None, optional path to heavy chain v germline fasta. Defaults to IGHV fasta in `$GERMLINE` environmental variable. germline : str | None, optional path to germline database folder. `None` defaults to `GERMLINE` environmental variable. org : Literal["human", "mouse"], optional organism of germline database. db : Literal["imgt", "ogrdb", "kiarva"], optional database to use for germline sequences. lightchain_db : Literal["imgt", "ogrdb"] | None, optional database to use for light chains. Only for `db="kiarva"`, `None` defaults to 'imgt' but this option can also be set to 'ogrdb' if desired. strain : Literal["c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J"] | None, optional strain of mouse to use for germline sequences. Only for `db="ogrdb"`. Note that only "c57bl6", "balbc", "CAST_EiJ", "LEWES_EiJ", "MSM_MsJ", "NOD_ShiLt_J" and "PWD_PhJ" contains both heavy chain and light chain germline sequences as a set. The rest will not allow igblastn and MakeDB.py to generate a successful airr table (check the failed file). "c57bl6" and "balbc" are merged databases of "C57BL_6" with "C57BL_6J" and "BALB_c" with "BALB_c_ByJ" respectively. None defaults to all combined. novel : bool, optional whether or not to run novel allele discovery during tigger-genotyping. plot : bool, optional whether or not to plot reassignment summary metrics. save_plot : bool, optional whether or not to save plot. show_plot : bool, optional whether or not to show plot. figsize : tuple[float, float], optional size of figure. sample_id_dictionary : dict[str, str] | None, optional dictionary for creating a sample_id column in the concatenated file. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. `None` defaults to 'all'. additional_args : dict[str, list[str]], optional additional arguments to pass to `tigger-genotype.R` and `CreateGermlines.py`. This accepts a dictionary with keys as the name of the sub-function (`tigger` or `creategermlines`) and the records as lists of arguments to pass to the relevant scripts/tools. Raises ------ FileNotFoundError if reannotated file is not found. """ fileformat = "blast" data, filename_prefix = check_data(data, filename_prefix) if db == "kiarva": db = ( "kiarva_imgt" if lightchain_db is None else f"kiarva_{lightchain_db}" ) informat_dict = { "changeo": "_igblast_db-pass.tsv", "blast": "_igblast_db-pass.tsv", "airr": "_igblast_gap.tsv", } germpass_dict = { "changeo": "_igblast_db-pass_germ-pass.tsv", "blast": "_igblast_db-pass_germ-pass.tsv", "airr": "_igblast_gap_germ-pass.tsv", } fileformat_dict = { "changeo": "_igblast_db-pass_genotyped.tsv", "blast": "_igblast_db-pass_genotyped.tsv", "airr": "_igblast_gap_genotyped.tsv", } fileformat_passed_dict = { "changeo": "_igblast_db-pass_genotyped_germ-pass.tsv", "blast": "_igblast_db-pass_genotyped_germ-pass.tsv", "airr": "_igblast_gap_genotyped_germ-pass.tsv", } inferred_fileformat_dict = { "changeo": "_igblast_db-pass_inferredGenotype.txt", "blast": "_igblast_db-pass_inferredGenotype.txt", "airr": "_igblast_gap_inferredGenotype.txt", } germline_dict = { "changeo": "_igblast_db-pass_genotype.fasta", "blast": "_igblast_db-pass_genotype.fasta", "airr": "_igblast_gap_genotype.fasta", } fform_dict = {"blast": "airr", "airr": "airr", "changeo": "changeo"} filepathlist_heavy = [] filepathlist_light = [] filePath = None sampleNames_dict = {} filePath_dict = {} for i in tqdm( range(0, len(data)), desc="Processing data file(s) ", bar_format="{l_bar}{bar:10}{r_bar}{bar:-10b}", ): filePath = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with=informat_dict[fileformat], sub_dir="tmp", ) if filePath is None: raise FileNotFoundError( "Path to .tsv file for {} is unknown. ".format(data[i]) + "Please specify path to reannotated .tsv file or folder " + "containing reannotated .tsv file." ) filePath_heavy = filePath.parent / ( filePath.stem + "_heavy_parse-select.tsv" ) filePath_light = filePath.parent / ( filePath.stem + "_light_parse-select.tsv" ) if sample_id_dictionary is not None: sampleNames_dict[filePath] = sample_id_dictionary[data[i]] else: sampleNames_dict[filePath] = str(data[i]) filePath_dict[str(data[i])] = filePath # splitting up to heavy chain and light chain files parsedb_heavy(filePath) parsedb_light(filePath) # add to counter filepathlist_heavy.append(filePath_heavy) filepathlist_light.append(filePath_light) # make output directory out_dir = Path(str(combined_folder)) out_dir.mkdir(parents=True, exist_ok=True) # concatenate if len(filepathlist_heavy) > 1: logg.info("Concatenating objects") try: cmd1 = " ".join( [ 'awk "FNR==1 && NR!=1 { while (/^sequence_id/) getline; } 1 {print}"' ] + [f for f in filepathlist_heavy] + [">"] + [ str( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]) ) ] ) cmd2 = " ".join( [ 'awk "FNR==1 && NR!=1 { while (/^sequence_id/) getline; } 1 {print}"' ] + [f for f in filepathlist_light] + [">"] + [ str( out_dir / (out_dir.stem + "_light" + informat_dict[fileformat]) ) ] ) os.system(cmd1) os.system(cmd2) except: # pragma: no cover fh = open( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]), "w", ) fh.close() with open( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]), "a", ) as out_file: for filenum, filename in enumerate(filepathlist_heavy): with open(filename) as in_file: for line_num, line in enumerate(in_file): if (line_num == 0) and (filenum > 0): continue out_file.write(line) fh = open( out_dir / (out_dir.stem + "_light" + informat_dict[fileformat]), "w", ) fh.close() with open( out_dir / (out_dir.stem + "_light" + informat_dict[fileformat]), "a", ) as out_file: for filenum, filename in enumerate(filepathlist_light): with open(filename) as in_file: skip_next_line = False for line_num, line in enumerate(in_file): if (line_num == 0) and (filenum > 0): continue out_file.write(line) else: shutil.copyfile( Path(filepathlist_heavy[0]), out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]), ) shutil.copyfile( Path(filepathlist_light[0]), out_dir / (out_dir.stem + "_light" + informat_dict[fileformat]), ) novel_dict = {True: "YES", False: "NO"} logg.info( " Do not worry about ERROR appearing below. There is a check in place to ensure that the script continues to run." ) if novel: try: logg.info( " Running tigger-genotype with novel allele discovery." ) tigger_genotype( airr_file=str( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]) ), v_germline=v_germline, org=org, fileformat=fform_dict[fileformat], novel_=novel_dict[novel], db=db, strain=strain, additional_args=additional_args["tigger"], ) creategermlines( airr_file=str( out_dir / (out_dir.stem + "_heavy" + fileformat_dict[fileformat]) ), germline=germline, org=org, genotyped_fasta=str( out_dir / (out_dir.stem + "_heavy" + germline_dict[fileformat]) ), mode="heavy", db=db, strain=strain, additional_args=["--vf", "v_call_genotyped"] + additional_args["creategermlines"], ) _ = load_data( out_dir / (out_dir.stem + "_heavy" + fileformat_passed_dict[fileformat]) ) except: try: logg.info(" Novel allele discovery execution halted.") logg.info( " Attempting to run tigger-genotype without novel allele discovery." ) tigger_genotype( airr_file=str( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]) ), v_germline=v_germline, org=org, fileformat=fform_dict[fileformat], novel_=novel_dict[False], db=db, strain=strain, additional_args=additional_args["tigger"], ) creategermlines( airr_file=str( out_dir / ( out_dir.stem + "_heavy" + fileformat_dict[fileformat] ) ), germline=germline, org=org, genotyped_fasta=str( out_dir / (out_dir.stem + "_heavy" + germline_dict[fileformat]) ), mode="heavy", db=db, strain=strain, additional_args=["--vf", "v_call_genotyped"] + additional_args["creategermlines"], ) _ = load_data( out_dir / ( out_dir.stem + "_heavy" + fileformat_passed_dict[fileformat] ) ) except: logg.info( " Insufficient contigs for running tigger-genotype. Defaulting to original heavy chain v_calls." ) tigger_failed = "" else: try: logg.info( " Running tigger-genotype without novel allele discovery." ) tigger_genotype( airr_file=str( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]) ), v_germline=v_germline, org=org, fileformat=fform_dict[fileformat], novel_=novel_dict[False], db=db, strain=strain, additional_args=additional_args["tigger"], ) creategermlines( airr_file=str( out_dir / (out_dir.stem + "_heavy" + fileformat_dict[fileformat]) ), germline=germline, org=org, genotyped_fasta=str( out_dir / (out_dir.stem + "_heavy" + germline_dict[fileformat]) ), mode="heavy", db=db, strain=strain, additional_args=["--vf", "v_call_genotyped"] + additional_args["creategermlines"], ) _ = load_data( str( out_dir / ( out_dir.stem + "_heavy" + fileformat_passed_dict[fileformat] ) ) ) except: logg.info( " Insufficient contigs for running tigger-genotype. Defaulting to original heavy chain v_calls." ) tigger_failed = "" if "tigger_failed" in locals(): creategermlines( airr_file=str( out_dir / (out_dir.stem + "_heavy" + informat_dict[fileformat]) ), germline=germline, org=org, genotyped_fasta=None, mode="heavy", db=db, strain=strain, additional_args=["--vf", "v_call"] + additional_args["creategermlines"], ) creategermlines( airr_file=str( out_dir / (out_dir.stem + "_light" + informat_dict[fileformat]) ), germline=germline, org=org, genotyped_fasta=None, mode="light", db=db, strain=strain, additional_args=["--vf", "v_call"] + additional_args["creategermlines"], ) if "tigger_failed" in locals(): try: heavy = load_data( out_dir / (out_dir.stem + "_heavy" + germpass_dict[fileformat]) ) except TypeError: # print error message and return warnings.warn( "Processing has failed for {}. Please check the error message for what went wrong.".format( { str( out_dir / ( out_dir.stem + "_heavy" + germpass_dict[fileformat] ) ) } ) ) return logg.info( " For convenience, entries for heavy chain in `v_call` are copied to `v_call_genotyped`." ) heavy["v_call_genotyped"] = heavy["v_call"] else: heavy = load_data( out_dir / (out_dir.stem + "_heavy" + fileformat_passed_dict[fileformat]) ) logg.info( " For convenience, entries for light chain `v_call` are copied to `v_call_genotyped`." ) light = load_data( out_dir / (out_dir.stem + "_light" + germpass_dict[fileformat]) ) light["v_call_genotyped"] = light["v_call"] sampledict = {} heavy["sample_id"], light["sample_id"] = None, None for file in sampleNames_dict.keys(): dat_f = load_data(file) dat_f["sample_id"] = sampleNames_dict[file] heavy.update(dat_f[["sample_id"]]) light.update(dat_f[["sample_id"]]) dat_ = pd.concat([heavy, light]) if "cell_id" in dat_.columns: dat_.sort_values(by="cell_id", inplace=True) else: dat_.sort_values(by="sequence_id", inplace=True) if plot: if "tigger_failed" not in locals(): # pragma: no cover logg.info("Returning summary plot") inferred_genotype = out_dir / ( out_dir.stem + "_heavy" + inferred_fileformat_dict[fileformat] ) inf_geno = pd.read_csv(inferred_genotype, sep="\t", dtype="object") s2 = set(inf_geno["gene"]) results = [] try: for samp in list(set(heavy["sample_id"])): res_x = heavy[(heavy["sample_id"] == samp)] V_ = [ re.sub("[*][0-9][0-9]", "", v) for v in res_x["v_call"] ] V_g = [ re.sub("[*][0-9][0-9]", "", v) for v in res_x["v_call_genotyped"] ] s1 = set( list( ",".join( [",".join(list(set(v.split(",")))) for v in V_] ).split(",") ) ) setdiff = s1 - s2 ambiguous = ( ["," in i for i in V_].count(True) / len(V_) * 100, ["," in i for i in V_g].count(True) / len(V_g) * 100, ) not_in_genotype = ( [i in setdiff for i in V_].count(True) / len(V_) * 100, [i in setdiff for i in V_g].count(True) / len(V_g) * 100, ) # FIXED: Create DataFrame correctly # Each tuple represents (before, after) for a metric stats = pd.DataFrame( { "before": [ambiguous[0], not_in_genotype[0]], "after": [ambiguous[1], not_in_genotype[1]], }, index=["ambiguous", "not_in_genotype"], ) stats.index.set_names(["vgroup"], inplace=True) stats.reset_index(drop=False, inplace=True) stats["sample_id"] = samp results.append(stats) results = pd.concat(results) ambiguous_table = results[results["vgroup"] == "ambiguous"] not_in_genotype_table = results[ results["vgroup"] == "not_in_genotype" ] ambiguous_table.reset_index(inplace=True, drop=True) not_in_genotype_table.reset_index(inplace=True, drop=True) # melting the dataframe ambiguous_table_before = ambiguous_table.drop("after", axis=1) ambiguous_table_before.rename( columns={"before": "var"}, inplace=True ) ambiguous_table_before["var_group"] = "before" ambiguous_table_after = ambiguous_table.drop("before", axis=1) ambiguous_table_after.rename( columns={"after": "var"}, inplace=True ) ambiguous_table_after["var_group"] = "after" ambiguous_table = pd.concat( [ambiguous_table_before, ambiguous_table_after] ) not_in_genotype_table_before = not_in_genotype_table.drop( "after", axis=1 ) not_in_genotype_table_before.rename( columns={"before": "var"}, inplace=True ) not_in_genotype_table_before["var_group"] = "before" not_in_genotype_table_after = not_in_genotype_table.drop( "before", axis=1 ) not_in_genotype_table_after.rename( columns={"after": "var"}, inplace=True ) not_in_genotype_table_after["var_group"] = "after" not_in_genotype_table = pd.concat( [not_in_genotype_table_before, not_in_genotype_table_after] ) ambiguous_table["var_group"] = ambiguous_table[ "var_group" ].astype("category") not_in_genotype_table["var_group"] = not_in_genotype_table[ "var_group" ].astype("category") ambiguous_table["var_group"] = ambiguous_table[ "var_group" ].cat.reorder_categories(["before", "after"]) not_in_genotype_table["var_group"] = not_in_genotype_table[ "var_group" ].cat.reorder_categories(["before", "after"]) options.figure_size = figsize final_table = pd.concat( [ambiguous_table, not_in_genotype_table] ) p = ( ggplot( final_table, aes(x="sample_id", y="var", fill="var_group"), ) + coord_flip() + theme_classic() + xlab("sample_id") + ylab("% allele calls") + ggtitle("Genotype reassignment with TIgGER") + geom_bar(stat="identity") + facet_grid("~" + "vgroup", scales="free_y") + scale_fill_manual(values=("#86bcb6", "#F28e2b")) + theme(legend_title=element_blank()) ) if save_plot: savefile = str( out_dir / (out_dir.stem + "_reassign_alleles.pdf") ) save_as_pdf_pages([p], filename=savefile, verbose=False) if show_plot: p.show() except: logg.info("Error in plotting encountered. Skipping.") pass else: pass sleep(0.5) # if split_write_out: if "tigger_failed" in locals(): logg.info( "Although tigger-genotype was not run successfully, file will still be saved with `_genotyped.tsv`" "extension for convenience." ) for s in tqdm( data, desc="Writing out to individual folders ", bar_format="{l_bar}{bar:10}{r_bar}{bar:-10b}", ): if sample_id_dictionary is not None: out_file = dat_[dat_["sample_id"] == sample_id_dictionary[s]] else: out_file = dat_[dat_["sample_id"] == s] outfilepath = filePath_dict[s] write_airr( out_file, outfilepath.parent / (outfilepath.stem + "_genotyped.tsv") )
def run_igblastn( fasta: Path | str, igblast_db: Path | str | None = None, org: Literal["human", "mouse"] = "human", loci: Literal["ig", "tr"] = "ig", evalue: float = 1e-4, min_d_match: int = 9, db: Literal[ "imgt", "ogrdb", "kiarva_imgt", "kiarva_ogrdb", "gkhlab" ] = "imgt", strain: ( Literal[ "c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J", ] | None ) = None, additional_args: list[str] = [], ): """ Reannotate with IgBLASTn. Parameters ---------- fasta : Path | str path to fasta file for reannotation. igblast_db : Path | str | None, optional path to igblast database. org : Literal["human", "mouse"], optional organism for germline sequences. loci : Literal["ig", "tr"], optional `ig` or `tr` mode for running igblastn. evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. min_d_match : int, optional minimum D nucleotide match. db : Literal["imgt", "ogrdb", "kiarva_imgt", "kiarva_ogrdb", "gkhlab"], optional database to use for germline sequences. For `db="kiarva_<db>"`, `mode="ig"` and `org="human"` is required. For `db="gkhlab"`, `mode="tr"` and `org="human"` is required. strain : Literal["c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J"] | None, optional strain of mouse to use for germline sequences. Only for `db="ogrdb"`. Note that only "c57bl6", "balbc", "CAST_EiJ", "LEWES_EiJ", "MSM_MsJ", "NOD_ShiLt_J" and "PWD_PhJ" contains both heavy chain and light chain germline sequences as a set. The rest will not allow igblastn and MakeDB.py to generate a successful airr table (check the failed file). "c57bl6" and "balbc" are merged databases of "C57BL_6" with "C57BL_6J" and "BALB_c" with "BALB_c_ByJ" respectively. None defaults to all combined. additional_args: list[str], optional additional arguments to pass to `igblastn`. """ env, igdb, fasta = set_igblast_env(igblast_db=igblast_db, input_file=fasta) outfolder = fasta.parent / "tmp" outfolder.mkdir(parents=True, exist_ok=True) informat_dict = {"blast": "_igblast.fmt7", "airr": "_igblast.tsv"} if db == "ogrdb": _strain = "_" + strain if strain is not None else "" aux = "_gl_ogrdb.aux" else: _strain = "" aux = "_gl.aux" loci_type = {"ig": "Ig", "tr": "TCR"} outformat = {"blast": "7 std qseq sseq btop", "airr": "19"} dbpath = igdb / "database" db_org_loci = db + "_" + org + _strain + "_" + loci + "_" vpath = dbpath / (db_org_loci + "v") if strain in NO_DS: dpath = dbpath / (db + "_" + org + "_" + loci + "_" + "d") else: dpath = dbpath / (db_org_loci + "d") jpath = dbpath / (db_org_loci + "j") if db == "ogrdb" and org == "human": cpath = dbpath / f"ogrdb_human_{loci}_c" elif db == "ogrdb" and org == "mouse": cpath = dbpath / f"ogrdb_{org}{_strain}_{loci}_c" elif db in {"kiarva_imgt", "kiarva_ogrdb"}: # These databases only exist for human IG cpath = dbpath / f"{db}_human_ig_c" elif db == "gkhlab": # This database only exists for human TR cpath = dbpath / "gkhlab_human_tr_c" else: # all other cases use IMGT for the constant region database cpath = dbpath / f"imgt_{org}_{loci}_c" auxpath = igdb / "optional_file" / (org + aux) for fileformat in ["blast", "airr"]: outfile = str(fasta.stem + informat_dict[fileformat]) if loci == "tr": cmd = [ "igblastn", "-germline_db_V", str(vpath), "-germline_db_D", str(dpath), "-germline_db_J", str(jpath), "-auxiliary_data", str(auxpath), "-domain_system", "imgt", "-ig_seqtype", loci_type[loci], "-organism", org, "-outfmt", outformat[fileformat], "-query", str(fasta), "-out", str(outfolder / outfile), "-evalue", str(evalue), "-min_D_match", str(min_d_match), "-D_penalty", str(-4), "-c_region_db", str(cpath), ] else: cmd = [ "igblastn", "-germline_db_V", str(vpath), "-germline_db_D", str(dpath), "-germline_db_J", str(jpath), "-auxiliary_data", str(auxpath), "-domain_system", "imgt", "-ig_seqtype", loci_type[loci], "-organism", org, "-outfmt", outformat[fileformat], "-query", str(fasta), "-out", str(outfolder / outfile), "-evalue", str(evalue), "-min_D_match", str(min_d_match), "-c_region_db", str(cpath), ] cmd += additional_args logg.info("Running command: %s\n" % (" ".join(cmd))) run(cmd, env=env) # logs are printed to terminal def assign_DJ( fasta: Path | str, org: Literal["human", "mouse"] = "human", loci: Literal["ig", "tr"] = "tr", call: Literal["d", "j"] = "j", database: str | None = None, evalue: float = 1e-4, max_hsps: int = 10, dust: str | None = None, word_size: int | None = None, outfmt: str = ( "6 qseqid sseqid pident length mismatch gapopen " + "qstart qend sstart send evalue bitscore qseq sseq" ), filename_prefix: str | None = None, overwrite: bool = False, db: Literal["imgt", "ogrdb"] = "imgt", strain: ( Literal[ "c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J", ] | None ) = None, additional_args: list[str] = [], ): """ Annotate contigs with constant region call using blastn. Parameters ---------- fasta : Path | str path to fasta file. org : Literal["human", "mouse"], optional organism of reference folder. loci : Literal["ig", "tr"], optional locus. 'ig' or 'tr', call : Literal["d", "j"], optional Either 'd' of 'j' gene. database : str | None, optional path to database. Defaults to `IGDATA` environmental variable if v/d/j_call. Defaults to `BLASTDB` environmental variable if c_call. evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. max_hsps : int, optional Maximum number of HSPs (alignments) to keep for any single query-subject pair. The HSPs shown will be the best as judged by expect value. This number should be an integer that is one or greater. Setting it to one will show only the best HSP for every query-subject pair. Only affects the output file in the tmp folder. dust : str | None, optional dustmasker options. Filter query sequence with DUST Format: 'yes', or 'no' to disable. Accepts str. If None, defaults to `20 64 1`. word_size : int | None, optional Word size for wordfinder algorithm (length of best perfect match). Must be >=4. `None` defaults to 4. outfmt : str, optional specification of output format for blast. filename_prefix : str | None, optional prefix of file name preceding '_contig'. `None` defaults to 'all'. overwrite : bool, optional whether or not to overwrite the assignments. db : Literal["imgt", "ogrdb"], optional database to use for germline sequences. strain : Literal["c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J"] | None, optional strain of mouse to use for germline sequences. Only for `db="ogrdb"`. Note that only "c57bl6", "balbc", "CAST_EiJ", "LEWES_EiJ", "MSM_MsJ", "NOD_ShiLt_J" and "PWD_PhJ" contains both heavy chain and light chain germline sequences as a set. The rest will not allow igblastn and MakeDB.py to generate a successful airr table (check the failed file). "c57bl6" and "balbc" are merged databases of "C57BL_6" with "C57BL_6J" and "BALB_c" with "BALB_c_ByJ" respectively. None defaults to all combined. additional_args: list[str], optional additional arguments to pass to `blastn`. """ # main function from here file_path, passfile, failfile = return_pass_fail_filepaths( fasta, filename_prefix=filename_prefix ) # run blast blast_out = run_blastn( fasta=file_path, database=database, org=org, loci=loci, call=call, max_hsps=max_hsps, evalue=evalue, outfmt=outfmt, dust=dust, word_size=word_size, db=db, strain=strain, additional_args=additional_args, ) transfer_assignment( passfile=passfile, failfile=failfile, blast_result=blast_out.drop_duplicates( subset="sequence_id", keep="first" ), call=call, overwrite=overwrite, ) def run_blastn( fasta: Path | str, database: str | None, org: Literal["human", "mouse"] = "human", loci: Literal["ig", "tr"] = "ig", call: Literal["v", "d", "j", "c"] = "c", max_hsps: int = 10, evalue: float = 1e-4, outfmt: str = ( "6 qseqid sseqid pident length mismatch gapopen " + "qstart qend sstart send evalue bitscore qseq sseq" ), dust: str | None = None, word_size: int | None = None, db: Literal[ "imgt", "ogrdb", "kiarva_imgt", "kiarva_ogrdb", "gkhlab" ] = "imgt", strain: ( Literal[ "c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J", ] | None ) = None, additional_args: list[str] = [], ) -> pd.DataFrame: """ Annotate contigs using blastn. Parameters ---------- fasta : Path | str path to fasta file. database : str | None path to database. Defaults to `IGDATA` environmental variable if v/d/j_call. Defaults to `BLASTDB` environmental variable if c_call. org : Literal["human", "mouse"], optional organism of reference folder. loci : Literal["ig", "tr"], optional locus. 'ig' or 'tr', call : Literal["v", "d", "j", "c"], optional Either 'v', 'd', 'j' or 'c' gene. max_hsps : int, optional Maximum number of HSPs (alignments) to keep for any single query-subject pair. The HSPs shown will be the best as judged by expect value. This number should be an integer that is one or greater. Setting it to one will show only the best HSP for every query-subject pair. Only affects the output file in the tmp folder. evalue : float, optional This is the statistical significance threshold for reporting matches against database sequences. Lower EXPECT thresholds are more stringent and report only high similarity matches. Choose higher EXPECT value (for example 1 or more) if you expect a low identity between your query sequence and the targets. outfmt : str, optional blastn output format. dust : str | None, optional dustmasker options. Filter query sequence with DUST Format: 'yes', or 'no' to disable. Accepts str. If None, defaults to `20 64 1`. word_size : int | None, optional Word size for wordfinder algorithm (length of best perfect match). Must be >=4. `None` defaults to 4. db : Literal["imgt", "ogrdb", "kiarva_imgt", "kiarva_ogrdb", "gkhlab"], optional database to use for germline sequences. For `db="kiarva_<db>"`, `mode="ig"` and `org="human"` is required. For `db="gkhlab"`, `mode="tr"` and `org="human"` is required. `call="c"` will ignore the `db` argument and use the database provided in the `database` argument. strain : Literal["c57bl6", "balbc", "129S1_SvImJ", "AKR_J", "A_J", "BALB_c_ByJ", "BALB_c", "C3H_HeJ", "C57BL_6J", "C57BL_6", "CAST_EiJ", "CBA_J", "DBA_1J", "DBA_2J", "LEWES_EiJ", "MRL_MpJ", "MSM_MsJ", "NOD_ShiLtJ", "NOR_LtJ", "NZB_BlNJ", "PWD_PhJ", "SJL_J"] | None, optional strain of mouse to use for germline sequences. Only for `db="ogrdb"`. Note that only "c57bl6", "balbc", "CAST_EiJ", "LEWES_EiJ", "MSM_MsJ", "NOD_ShiLt_J" and "PWD_PhJ" contains both heavy chain and light chain germline sequences as a set. The rest will not allow igblastn and MakeDB.py to generate a successful airr table (check the failed file). "c57bl6" and "balbc" are merged databases of "C57BL_6" with "C57BL_6J" and "BALB_c" with "BALB_c_ByJ" respectively. None defaults to all combined. additional_args: list[str], optional additional arguments to pass to `blastn`. Returns ------- pd.DataFrame reannotated information after blastn. """ if call != "c": env, bdb, fasta = set_igblast_env(igblast_db=database, input_file=fasta) if db == "ogrdb": _strain = "_" + strain if strain is not None else "" bdb = ( bdb / "database" / (db + "_" + org + _strain + "_" + loci + "_" + call) ) else: bdb = bdb / "database" / (db + "_" + org + "_" + loci + "_" + call) else: env, bdb, fasta = set_blast_env(blast_db=database, input_file=fasta) bdb = bdb / org / (org + "_BCR_C.fasta") if database is None else bdb # else: # if not bdb.stem.endswith("_" + loci + "_" + call): # bdb = ( # bdb # / "database" # / (db + "_" + org + "_" + loci + "_" + call) # ) cmd = [ "blastn", "-db", str(bdb), "-evalue", str(evalue), "-max_hsps", str(max_hsps), "-outfmt", outfmt, "-query", str(fasta), ] if dust is not None: cmd = cmd + ["-dust", str(dust)] if word_size is not None: cmd = cmd + ["-word_size", str(word_size)] cmd = cmd + additional_args blast_out = fasta.parent / "tmp" / (fasta.stem + "_" + call + "_blast.tsv") logg.info("Running command: %s\n" % (" ".join(cmd))) with open(blast_out, "w") as out: run(cmd, stdout=out, env=env) try: dat = pd.read_csv(blast_out, sep="\t", header=None) dat.columns = [ "sequence_id", call + "_call", call + "_identity", call + "_alignment_length", call + "_number_of_mismatches", call + "_number_of_gap_openings", call + "_sequence_start", call + "_sequence_end", call + "_germline_start", call + "_germline_end", call + "_support", call + "_score", call + "_sequence_alignment", call + "_germline_alignment", ] except pd.errors.EmptyDataError: dat = pd.DataFrame( columns=[ "sequence_id", call + "_call", call + "_identity", call + "_alignment_length", call + "_number_of_mismatches", call + "_number_of_gap_openings", call + "_sequence_start", call + "_sequence_end", call + "_germline_start", call + "_germline_end", call + "_support", call + "_score", call + "_sequence_alignment", call + "_germline_alignment", ] ) write_blastn(data=dat, save=blast_out) dat = load_data(dat) return dat def transfer_assignment( passfile: str, failfile: str, blast_result: pd.DataFrame, call: Literal["v", "d", "j", "c"] = "c", overwrite: bool = False, ): """Update gene calls with blastn results. Parameters ---------- passfile : str path to db-pass.tsv file. failfile : str path to db-fail.tsv file. blast_result : pd.DataFrame path to blastn results file. call : Literal["v", "d", "j", "c"], optional which gene call. overwrite : bool, optional whether or not to overwrite. """ if os.path.isfile(passfile): db_pass = load_data(passfile) else: db_pass = None if os.path.isfile(failfile): db_fail = load_data(failfile) # should be pretty safe to fill this in db_fail["vj_in_frame"] = db_fail["vj_in_frame"].fillna(value="F") db_fail["productive"] = db_fail["productive"].fillna(value="F") db_fail["c_call"] = db_fail["c_call"].fillna(value="") db_fail["v_call"] = db_fail["v_call"].fillna(value="") db_fail["d_call"] = db_fail["d_call"].fillna(value="") db_fail["j_call"] = db_fail["j_call"].fillna(value="") db_fail["locus"] = db_fail["locus"].fillna(value="") for i, row in db_fail.iterrows(): if not present(row.locus): calls = list( { row.v_call[:3], row.d_call[:3], row.j_call[:3], row.c_call[:3], } ) locus = "".join([c for c in calls if present(c)]) if len(locus) == 3: db_fail.at[i, "locus"] = locus else: db_fail = None if blast_result.shape[0] < 1: blast_result = None if blast_result is not None: if db_pass is not None: if call + "_support" in db_pass: db_pass_evalues = dict(db_pass[call + "_support"]) if call + "_score" in db_pass: db_pass_scores = dict(db_pass[call + "_score"]) db_pass[call + "_call"] = db_pass[call + "_call"].fillna(value="") db_pass_call = dict(db_pass[call + "_call"]) if call + "_support" in db_pass: db_pass[call + "_support_igblastn"] = pd.Series(db_pass_evalues) if call + "_score" in db_pass: db_pass[call + "_score_igblastn"] = pd.Series(db_pass_scores) db_pass[call + "_call_igblastn"] = pd.Series(db_pass_call) db_pass[call + "_call_igblastn"] = db_pass[ call + "_call_igblastn" ].fillna(value="") for col in blast_result: if col not in ["sequence_id", "cell_id"]: db_pass[col + "_blastn"] = pd.Series(blast_result[col]) if col in [ call + "_call", call + "_sequence_alignment", call + "_germline_alignment", ]: db_pass[col + "_blastn"] = db_pass[ col + "_blastn" ].fillna(value="") db_pass[call + "_source"] = "" if overwrite: for i in db_pass["sequence_id"]: vend = db_pass.loc[i, "v_sequence_end"] if not present(vend): vend_ = 0 else: vend_ = vend jstart = db_pass.loc[i, "j_sequence_start"] if not present(jstart): jstart_ = 1000 else: jstart_ = jstart callstart = db_pass.loc[i, call + "_sequence_start_blastn"] callend = db_pass.loc[i, call + "_sequence_end_blastn"] if (callstart >= vend_) and (callend <= jstart_): if call + "_support_igblastn" in db_pass: eval1 = db_pass.loc[i, call + "_support_igblastn"] else: eval1 = 1 eval2 = db_pass.loc[i, call + "_support_blastn"] if ( db_pass.loc[i, call + "_call_igblastn"] != db_pass.loc[i, call + "_call_blastn"] ): if call + "_call_10x" in db_pass: if ( re.sub( "[*][0-9][0-9]", "", db_pass.loc[i, call + "_call_blastn"], ) != db_pass.loc[i, call + "_call_10x"] ): if present(eval1): if eval1 > eval2: db_pass.at[i, call + "_call"] = ( db_pass.at[ i, call + "_call_blastn" ] ) db_pass.at[ i, call + "_sequence_start" ] = db_pass.at[ i, call + "_sequence_start_blastn", ] db_pass.at[ i, call + "_sequence_end" ] = db_pass.at[ i, call + "_sequence_end_blastn" ] db_pass.at[ i, call + "_germline_start" ] = db_pass.at[ i, call + "_germline_start_blastn", ] db_pass.at[ i, call + "_germline_end" ] = db_pass.at[ i, call + "_germline_end_blastn" ] db_pass.at[i, call + "_source"] = ( "blastn" ) else: # pragma: no cover if present(eval2): db_pass.at[i, call + "_call"] = ( db_pass.at[ i, call + "_call_blastn" ] ) db_pass.at[ i, call + "_sequence_start" ] = db_pass.at[ i, call + "_sequence_start_blastn", ] db_pass.at[ i, call + "_sequence_end" ] = db_pass.at[ i, call + "_sequence_end_blastn" ] db_pass.at[ i, call + "_germline_start" ] = db_pass.at[ i, call + "_germline_start_blastn", ] db_pass.at[ i, call + "_germline_end" ] = db_pass.at[ i, call + "_germline_end_blastn" ] db_pass.at[i, call + "_source"] = ( "blastn" ) else: db_pass.at[i, call + "_source"] = "10x" db_pass.at[i, call + "_call"] = db_pass.at[ i, call + "_call_blastn" ] if present(db_pass.loc[i, "junction_10x"]): if present(db_pass.loc[i, "junction"]): if ( db_pass.loc[i, "junction"] != db_pass.loc[ i, "junction_10x" ] ): # pragma: no cover db_pass.at[i, "junction"] = ( db_pass.at[ i, "junction_10x" ] ) db_pass.at[i, "junction_aa"] = ( db_pass.at[ i, "junction_10x_aa" ] ) else: if present(eval1): if eval1 > eval2: db_pass.at[i, call + "_call"] = db_pass.at[ i, call + "_call_blastn" ] db_pass.at[i, call + "_sequence_start"] = ( db_pass.at[ i, call + "_sequence_start_blastn" ] ) db_pass.at[i, call + "_sequence_end"] = ( db_pass.at[ i, call + "_sequence_end_blastn" ] ) db_pass.at[i, call + "_germline_start"] = ( db_pass.at[ i, call + "_germline_start_blastn" ] ) db_pass.at[i, call + "_germline_end"] = ( db_pass.at[ i, call + "_germline_end_blastn" ] ) db_pass.at[i, call + "_source"] = "blastn" else: # pragma: no cover if present(eval2): db_pass.at[i, call + "_call"] = db_pass.at[ i, call + "_call_blastn" ] db_pass.at[i, call + "_sequence_start"] = ( db_pass.at[ i, call + "_sequence_start_blastn" ] ) db_pass.at[i, call + "_sequence_end"] = ( db_pass.at[ i, call + "_sequence_end_blastn" ] ) db_pass.at[i, call + "_germline_start"] = ( db_pass.at[ i, call + "_germline_start_blastn" ] ) db_pass.at[i, call + "_germline_end"] = ( db_pass.at[ i, call + "_germline_end_blastn" ] ) db_pass.at[i, call + "_source"] = "blastn" vend = db_pass["v_sequence_end"] dstart = db_pass["d_sequence_start"] dend = db_pass["d_sequence_end"] jstart = db_pass["j_sequence_start"] np1 = [ str(int(n)) if n >= 0 else "" for n in [ ( (d - v) - 1 if pd.notnull(v) and pd.notnull(d) else np.nan ) for v, d in zip(vend, dstart) ] ] np2 = [ str(int(n)) if n >= 0 else "" for n in [ ( (j - d) - 1 if pd.notnull(j) and pd.notnull(d) else np.nan ) for d, j in zip(dend, jstart) ] ] db_pass["np1_length"] = np1 db_pass["np2_length"] = np2 for i in db_pass["sequence_id"]: if not present(db_pass.loc[i, "np1_length"]): vend = db_pass.loc[i, "v_sequence_end"] if present(vend): jstart = db_pass.loc[i, "j_sequence_start"] if present(jstart): np1l = (jstart - vend) - 1 if np1l >= 0: db_pass.loc[i, "np1_length"] = np1l # fill in blanks db_pass = sanitize_data(db_pass) db_pass.to_csv(passfile, sep="\t", index=False) if db_fail is not None: if call + "_support" in db_fail: db_fail_evalues = dict(db_fail[call + "_support"]) if call + "_score" in db_fail: db_fail_scores = dict(db_fail[call + "_score"]) db_fail[call + "_call"] = db_fail[call + "_call"].fillna(value="") db_fail_call = dict(db_fail[call + "_call"]) if call + "_support" in db_fail: db_fail[call + "_support_igblastn"] = pd.Series(db_fail_evalues) if call + "_score" in db_fail: db_fail[call + "_score_igblastn"] = pd.Series(db_fail_scores) db_fail[call + "_call_igblastn"] = pd.Series(db_fail_call) db_fail[call + "_call_igblastn"] = db_fail[ call + "_call_igblastn" ].fillna(value="") for col in blast_result: if col not in ["sequence_id", "cell_id"]: db_fail[col + "_blastn"] = pd.Series(blast_result[col]) if col in [ call + "_call", call + "_sequence_alignment", call + "_germline_alignment", ]: db_fail[col + "_blastn"] = db_fail[ col + "_blastn" ].fillna(value="") db_fail[call + "_source"] = "" if overwrite: for i in db_fail["sequence_id"]: vend = db_fail.loc[i, "v_sequence_end"] if not present(vend): vend_ = 0 else: vend_ = vend jstart = db_fail.loc[i, "j_sequence_start"] if not present(jstart): jstart_ = 1000 else: jstart_ = jstart callstart = db_fail.loc[i, call + "_sequence_start_blastn"] callend = db_fail.loc[i, call + "_sequence_end_blastn"] if (callstart >= vend_) and (callend <= jstart_): if call + "_support_igblastn" in db_fail: eval1 = db_fail.loc[i, call + "_support_igblastn"] else: eval1 = 1 eval2 = db_fail.loc[i, call + "_support_blastn"] if ( db_fail.loc[i, call + "_call_igblastn"] != db_fail.loc[i, call + "_call_blastn"] ): if call + "_call_10x" in db_fail: if ( re.sub( "[*][0-9][0-9]", "", db_fail.loc[i, call + "_call_blastn"], ) != db_fail.loc[i, call + "_call_10x"] ): if present(eval1): if eval1 > eval2: # pragma: no cover db_fail.at[i, call + "_call"] = ( db_fail.at[ i, call + "_call_blastn" ] ) db_fail.at[ i, call + "_sequence_start" ] = db_fail.at[ i, call + "_sequence_start_blastn", ] db_fail.at[ i, call + "_sequence_end" ] = db_fail.at[ i, call + "_sequence_end_blastn" ] db_fail.at[ i, call + "_germline_start" ] = db_fail.at[ i, call + "_germline_start_blastn", ] db_fail.at[ i, call + "_germline_end" ] = db_fail.at[ i, call + "_germline_end_blastn" ] db_fail.at[i, call + "_source"] = ( "blastn" ) else: if present(eval2): db_fail.at[i, call + "_call"] = ( db_fail.at[ i, call + "_call_blastn" ] ) db_fail.at[ i, call + "_sequence_start" ] = db_fail.at[ i, call + "_sequence_start_blastn", ] db_fail.at[ i, call + "_sequence_end" ] = db_fail.at[ i, call + "_sequence_end_blastn" ] db_fail.at[ i, call + "_germline_start" ] = db_fail.at[ i, call + "_germline_start_blastn", ] db_fail.at[ i, call + "_germline_end" ] = db_fail.at[ i, call + "_germline_end_blastn" ] db_fail.at[i, call + "_source"] = ( "blastn" ) else: db_fail.at[i, call + "_source"] = "10x" db_fail.at[i, call + "_call"] = db_fail.at[ i, call + "_call_blastn" ] if present(db_fail.loc[i, "junction_10x"]): if present(db_fail.loc[i, "junction"]): if ( db_fail.loc[i, "junction"] != db_fail.loc[ i, "junction_10x" ] ): # pragma: no cover db_fail.at[i, "junction"] = ( db_fail.at[ i, "junction_10x" ] ) db_fail.at[i, "junction_aa"] = ( db_fail.at[ i, "junction_10x_aa" ] ) else: if present(eval1): if eval1 > eval2: db_fail.at[i, call + "_call"] = db_fail.at[ i, call + "_call_blastn" ] db_fail.at[i, call + "_sequence_start"] = ( db_fail.at[ i, call + "_sequence_start_blastn" ] ) db_fail.at[i, call + "_sequence_end"] = ( db_fail.at[ i, call + "_sequence_end_blastn" ] ) db_fail.at[i, call + "_germline_start"] = ( db_fail.at[ i, call + "_germline_start_blastn" ] ) db_fail.at[i, call + "_germline_end"] = ( db_fail.at[ i, call + "_germline_end_blastn" ] ) db_fail.at[i, call + "_source"] = "blastn" else: # pragma: no cover if present(eval2): db_fail.at[i, call + "_call"] = db_fail.at[ i, call + "_call_blastn" ] db_fail.at[i, call + "_sequence_start"] = ( db_fail.at[ i, call + "_sequence_start_blastn" ] ) db_fail.at[i, call + "_sequence_end"] = ( db_fail.at[ i, call + "_sequence_end_blastn" ] ) db_fail.at[i, call + "_germline_start"] = ( db_fail.at[ i, call + "_germline_start_blastn" ] ) db_fail.at[i, call + "_germline_end"] = ( db_fail.at[ i, call + "_germline_end_blastn" ] ) db_fail.at[i, call + "_source"] = "blastn" vend = db_fail["v_sequence_end"] dstart = db_fail["d_sequence_start"] dend = db_fail["d_sequence_end"] jstart = db_fail["j_sequence_start"] np1 = [ str(int(n)) if n >= 0 else "" for n in [ ( (d - v) - 1 if pd.notnull(v) and pd.notnull(d) else np.nan ) for v, d in zip(vend, dstart) ] ] np2 = [ str(int(n)) if n >= 0 else "" for n in [ ( (j - d) - 1 if pd.notnull(j) and pd.notnull(d) else np.nan ) for d, j in zip(dend, jstart) ] ] db_fail["np1_length"] = np1 db_fail["np2_length"] = np2 # rescue the d blanks for i in db_fail["sequence_id"]: if not present(db_fail.loc[i, "np1_length"]): vend = db_fail.loc[i, "v_sequence_end"] if present(vend): jstart = db_fail.loc[i, "j_sequence_start"] if present(jstart): np1l = (jstart - vend) - 1 if np1l >= 0: db_fail.loc[i, "np1_length"] = np1l # fill in blanks db_fail = sanitize_data(db_fail) db_fail.to_csv(failfile, sep="\t", index=False)
[docs] def check_contigs( data: Dandelion | pd.DataFrame | str, adata: AnnData | None = None, productive_only: bool = True, library_type: Literal["ig", "tr-ab", "tr-gd"] | None = None, umi_foldchange_cutoff: int = 2, consensus_foldchange_cutoff: int = 5, ntop_vdj: int = 1, ntop_vj: int = 2, allow_exceptions: bool = True, filter_missing: bool = True, filter_extra: bool = True, filter_ambiguous: bool = False, filter_pseudo: dict[str, list[str]] | None = None, save: str | None = None, verbose: bool = True, **kwargs, ) -> tuple[Dandelion, AnnData]: """ Check contigs for whether they can be considered as ambiguous or not. Returns an `ambiguous` column with boolean T/F in the data. If the `sequence_alignment` is an exact match between contigs, the contigs will be merged into the one with the highest umi count, summing the umi/duplicate count. After this check, if there are still multiple contigs, cells with multiple contigs checked for whether there is a clear dominance in terms of UMI count resulting in two scenarios: 1) if true, all other contigs will be flagged as ambiguous; 2) if false, all contigs will be flagged as ambiguous. This is repeated for each cell, for their productive and non-productive VDJ and VJ contigs separately. Dominance is assessed by whether or not the umi counts demonstrate a > umi_foldchange_cutoff. There are some exceptions: 1) IgM and IgD are allowed to co-exist in the same B cell if no other isotypes are detected; 2) TRD and TRB contigs are allowed in the same cell because rearrangement of TRB and TRD loci happens at the same time during development and TRD variable region genes exhibits allelic inclusion. Thus this can potentially result in some situations where T cells expressing productive TRA-TRB chains can also express productive TRD chains. This can be toggled by `allow_exceptions` argument. Default behvaiour is to only consider productive contigs and remove all non-productive before checking, toggled by `productive_only` argument. If library_type is provided, it will remove all contigs that do not belong to the related loci. The rationale is that the choice of the library type should mean that the primers used would most likely amplify those related sequences and if there's any unexpected loci, they likely represent artifacts and shouldn't be analysed. If an `adata` object is provided, contigs with no corresponding cell barcode in the AnnData object is filtered in the output if filter_missing is True. Parameters ---------- data : Dandelion | pd.DataFrame | str V(D)J AIRR data to check. Can be Dandelion, pandas DataFrame and file path to AIRR `.tsv` file. adata : AnnData | None, optional AnnData object to filter. If not provided, it will assume to keep all cells in the airr table and just return a Dandelion object. productive_only : bool, optional whether or not to retain only productive contigs. library_type : Literal["ig", "tr-ab", "tr-gd"] | None, optional if specified, it will first filter based on the expected type of contigs: `ig`: IGH, IGK, IGL `tr-ab`: TRA, TRB `tr-gd`: TRG, TRD umi_foldchange_cutoff : int, optional related to minimum fold change of UMI count, required to rescue contigs/barcode otherwise they will be marked as extra/ambiguous. consensus_foldchange_cutoff : int, optional related to minimum fold change of consensus count, required to rescue contigs/barcode otherwise they will be marked as extra/ambiguous. ntop_vdj : int, optional number of top VDJ contigs to consider for dominance check. ntop_vj : int, optional number of top VJ contigs to consider for dominance check. allow_exceptions : bool, optional whether or not to allow exceptions for certain loci. filter_missing : bool, optional cells in V(D)J data not found in AnnData object will removed from the dandelion object. filter_extra : bool, optional whether or not to remove contigs that are marked as extra. filter_ambiguous : bool, optional whether or not to remove contigs that are marked as ambiguous. This step is only for cleaning up the `.data` slot as the ambiguous contigs are not passed to the `.metadata` slot anyway. filter_pseudo : dict[str, list[str]], optional Dictionary specifying how rows/contigs would be filtered based on gene functionality. Keys are "v", "d", "j" and values are lists of functionality strings to filter out. For instance, to only keep functional genes, you would set `filter_pseudo={"v": ["P", "ORF"], "d": ["P", "ORF"], "j": ["P", "ORF"]}`. None defaults to no filtering based on gene functionality. Requires that functionality columns (`v_call_functionality`, `d_call_functionality`, `j_call_functionality`) are present in the AIRR table, populated by `ddl.pp.annotate_functionality`. save : str | None, optional Only used if a pandas data frame or dandelion object is provided. Specifying will save the formatted vdj table with a `_checked.tsv` suffix extension. verbose : bool, optional whether to print progress when marking contigs. **kwargs additional kwargs passed to `dandelion.utilities._core.Dandelion`. Returns ------- tuple[Dandelion, AnnData] checked dandelion V(D)J object and AnnData object. Raises ------ IndexError if no contigs passed filtering. ValueError if save file name is not suitable. """ start = logg.info("Filtering contigs") if isinstance(data, Dandelion): dat_ = load_data(data._data) else: dat_ = load_data(data) # ensure that "unknown" are switched to blanks dat_.replace("unknown", "", inplace=True) if library_type is not None: acceptable = lib_type(library_type) else: if isinstance(data, Dandelion): if data.library_type is not None: acceptable = lib_type(data.library_type) else: acceptable = None else: acceptable = None if productive_only: dat = dat_[dat_["productive"].isin(TRUES)].copy() else: dat = dat_.copy() if acceptable is not None: dat = dat[dat.locus.isin(acceptable)].copy() # Filter out contigs based on gene functionality calls, if requested # and if the relevant functionality columns are present (e.g. from a # prior gene functionality annotation step). This runs before # MarkAmbiguousContigs so that dropped contigs aren't considered when # assessing ambiguity/dominance. _default_filter_pseudo: dict[str, list[str]] = {"v": [], "d": [], "j": []} if filter_pseudo is not None: _default_filter_pseudo.update(filter_pseudo) filter_pseudo = _default_filter_pseudo if any(len(drop_values) > 0 for drop_values in filter_pseudo.values()): for gene, drop_values in filter_pseudo.items(): if not drop_values: continue func_col = f"{gene}_call_functionality" if func_col not in dat.columns: if verbose: logg.info( f"'{func_col}' column not found; skipping " f"functionality-based filtering for {gene}_call." ) continue drop_upper = {str(v).upper() for v in drop_values} call_upper = dat[func_col].astype(str).str.upper() is_missing = dat[func_col].isnull() | ( dat[func_col].astype(str) == "" ) dat = dat[is_missing | ~call_upper.isin(drop_upper)].copy() barcode = list(set(dat.cell_id)) if adata is not None: adata_provided = True adata_ = adata.copy() contig_check = pd.DataFrame(index=adata_.obs_names) bc_ = {} for b in barcode: bc_.update({b: "True"}) contig_check["has_contig"] = pd.Series(bc_) contig_check["has_contig"] = contig_check["has_contig"].replace( np.nan, "No_contig" ) adata_.obs["has_contig"] = pd.Series(contig_check["has_contig"]) else: adata_provided = False obs = pd.DataFrame(index=barcode) adata_ = ad.AnnData(obs=obs) adata_.obs["has_contig"] = "True" contig_status = MarkAmbiguousContigs( dat, umi_foldchange_cutoff, consensus_foldchange_cutoff, ntop_vdj, ntop_vj, allow_exceptions, verbose, ) ambigous = contig_status.ambiguous_contigs.copy() extra = contig_status.extra_contigs.copy() umi_adjustment = contig_status.umi_adjustment.copy() if len(umi_adjustment) > 0: for k, v in umi_adjustment.items(): if k in dat.index: dat.at[k, "umi_count"] = v ambi = {c: "F" for c in dat_.sequence_id} ambiguous_ = {x: "T" for x in ambigous} ambi.update(ambiguous_) dat["ambiguous"] = pd.Series(ambi) extr = {c: "F" for c in dat_.sequence_id} extra_ = {x: "T" for x in extra} extr.update(extra_) dat["extra"] = pd.Series(extr) if filter_missing: dat = dat[dat["cell_id"].isin(adata_.obs_names)].copy() if dat.shape[0] == 0: raise IndexError( "No contigs passed filtering. Are you sure that the cell barcodes are matching?" ) if os.path.isfile(str(data)): data_path = Path(data) write_airr( dat, data_path.parent / "{}_checked.tsv".format(data_path.stem) ) else: if save is not None: if save.endswith(".tsv"): write_airr(dat, save) else: raise ValueError( "{} not suitable. Please provide a file name that ends with .tsv".format( str(save) ) ) if productive_only: for i, row in dat.iterrows(): if i in dat_.index: dat_.at[i, "umi_count"] = row["umi_count"] for column in ["ambiguous", "extra"]: dat_[column] = dat[column] dat_[column] = dat_[column].fillna("T") dat = dat_.copy() if filter_extra: dat = dat[dat["extra"] == "F"].copy() if filter_ambiguous: dat = dat[dat["ambiguous"] == "F"].copy() logg.info("Initializing Dandelion object") out_dat = Dandelion(data=dat, verbose=False, **kwargs) if isinstance(data, Dandelion): out_dat.germline = data.germline if adata_provided: transfer(adata_, out_dat) return (out_dat, adata_) else: return out_dat
class MarkAmbiguousContigs: """ `MarkAmbiguousContigs` class object. Attributes ---------- Cell : dandelion.utilities._utilities.Tree nested dictionary of cells. ambiguous_contigs : list[str] list of `sequence_id`s that are ambiguous. extra_contigs : list[str] list of `sequence_id`s that are extra. umi_adjustment : dict[str, int] dictionary of `sequence_id`s with adjusted umi value. """ def __init__( self, data: pd.DataFrame, umi_foldchange_cutoff: int | float, consensus_foldchange_cutoff: int | float, ntop_vdj: int, ntop_vj: int, allow_exceptions: bool, verbose: bool, ): """Init method for MarkAmbiguousContigs. Parameters ---------- data : pd.DataFrame AIRR data frame in Dandelion.data. umi_foldchange_cutoff : int | float fold-change cut off for decision for umi count. consensus_foldchange_cutoff : int | float fold-change cut off for decision for consensus count. ntop_vdj : int number of top VDJ contigs to consider for dominance check. ntop_vj : int number of top VJ contigs to consider for dominance check. allow_exceptions : bool whether or not to allow exceptions. verbose : bool whether or not to print progress. """ self.Cell = Tree() self.ambiguous_contigs = [] self.extra_contigs = [] self.umi_adjustment = {} if "v_call_genotyped" in data.columns: v_dict = dict(zip(data["sequence_id"], data["v_call_genotyped"])) else: v_dict = dict(zip(data["sequence_id"], data["v_call"])) d_dict = dict(zip(data["sequence_id"], data["d_call"])) j_dict = dict(zip(data["sequence_id"], data["j_call"])) c_dict = dict(zip(data["sequence_id"], data["c_call"])) for contig, row in tqdm( data.iterrows(), desc="Preparing data", ): cell = row["cell_id"] if row["locus"] in HEAVYLONG: if row["productive"] in TRUES: self.Cell[cell]["VDJ"]["P"][contig].update(row) elif row["productive"] in FALSES: self.Cell[cell]["VDJ"]["NP"][contig].update(row) elif row["locus"] in LIGHTSHORT: if row["productive"] in TRUES: self.Cell[cell]["VJ"]["P"][contig].update(row) elif row["productive"] in FALSES: self.Cell[cell]["VJ"]["NP"][contig].update(row) for cell in tqdm( self.Cell, desc="Scanning for poor quality/ambiguous contigs", bar_format="{l_bar}{bar:10}{r_bar}{bar:-10b}", disable=not verbose, ): if len(self.Cell[cell]["VDJ"]["P"]) > 0: # VDJ productive data1 = pd.DataFrame( [ self.Cell[cell]["VDJ"]["P"][x] for x in self.Cell[cell]["VDJ"]["P"] if isinstance(self.Cell[cell]["VDJ"]["P"][x], dict) ], index=[ self.Cell[cell]["VDJ"]["P"][x]["sequence_id"] for x in self.Cell[cell]["VDJ"]["P"] if isinstance(self.Cell[cell]["VDJ"]["P"][x], dict) ], ) vdj_p = list(data1["sequence_id"]) vdj_ccall_p = list(data1["c_call"]) vdj_locus_p = list(data1["locus"]) if len(vdj_p) > 1: if "sequence_alignment" in data1: ( data1, vdj_p, _, vdj_ccall_p, umi_adjust_vdj, ambi_cont_vdj, ) = check_update_same_seq(data1) if len(umi_adjust_vdj) > 0: self.umi_adjustment.update(umi_adjust_vdj) if len(ambi_cont_vdj) > 0: for avdj in ambi_cont_vdj: self.ambiguous_contigs.append(avdj) if len(vdj_p) > 1: if allow_exceptions: if "IGHD" in vdj_ccall_p: if all( x in ["IGHM", "IGHD"] for x in vdj_ccall_p ): if len(list(set(vdj_ccall_p))) == 2: # the v and j should be the same in order to keep as exception vdj_vcall_p = ( list(data1["v_call_genotyped"]) if "v_call_genotyped" in data1.columns else list(data1["v_call"]) ) vdj_jcall_p = list(data1["j_call"]) if ( len(set(vdj_vcall_p)) == 1 & len(set(vdj_jcall_p)) == 1 ): vdj_ccall_p_igm_count = dict( data1[ data1["c_call"] == "IGHM" ]["umi_count"].astype(int) ) vdj_ccall_c_igm_count = dict( data1[ data1["c_call"] == "IGHM" ]["consensus_count"].astype(int) ) vdj_ccall_p_igd_count = dict( data1[ data1["c_call"] == "IGHD" ]["umi_count"].astype(int) ) vdj_ccall_c_igd_count = dict( data1[ data1["c_call"] == "IGHD" ]["consensus_count"].astype(int) ) else: ( vdj_ccall_p_igm_count, vdj_ccall_p_igd_count, vdj_ccall_c_igm_count, vdj_ccall_c_igd_count, ) = ({}, {}, {}, {}) vdj_ccall_p_count = dict( data1["umi_count"].astype(int) ) vdj_ccall_c_count = dict( data1["consensus_count"].astype( int ) ) if len(vdj_ccall_p_count) > 1: ( vdj_p, extra_vdj, ambiguous_vdj, ) = check_productive_chain( umi_counts=vdj_ccall_p_count, consensus_counts=vdj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: ( vdj_p, extra_vdj, ambiguous_vdj, ) = ( [], [], [], ) else: ( vdj_ccall_p_igm_count, vdj_ccall_p_igd_count, vdj_ccall_c_igm_count, vdj_ccall_c_igd_count, ) = ({}, {}, {}, {}) if len(vdj_ccall_p_igm_count) > 1: ( keep_igm, extra_igm, ambiguous_igm, ) = check_productive_chain( umi_counts=vdj_ccall_p_igm_count, consensus_counts=vdj_ccall_c_igm_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: keep_igm, extra_igm, ambiguous_igm = ( [], [], [], ) if len(vdj_ccall_p_igd_count) > 1: ( keep_igd, extra_igd, ambiguous_igd, ) = check_productive_chain( umi_counts=vdj_ccall_p_igd_count, consensus_counts=vdj_ccall_c_igd_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: keep_igd, extra_igd, ambiguous_igd = ( [], [], [], ) if "vdj_p" not in locals(): vdj_p = keep_igm + keep_igd if "extra_vdj" not in locals(): extra_vdj = extra_igm + extra_igd if "ambiguous_vdj" not in locals(): ambiguous_vdj = ( ambiguous_igm + ambiguous_igd ) else: vdj_ccall_p_count = dict( data1["umi_count"].astype(int) ) vdj_ccall_c_count = dict( data1["consensus_count"].astype(int) ) if len(vdj_ccall_p_count) > 1: ( vdj_p, extra_vdj, ambiguous_vdj, ) = check_productive_chain( umi_counts=vdj_ccall_p_count, consensus_counts=vdj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: vdj_p, extra_vdj, ambiguous_vdj = ( [], [], [], ) elif all(x in ["TRB", "TRD"] for x in vdj_locus_p): if len(list(set(vdj_locus_p))) == 2: vdj_locus_p_trb_count = dict( data1[data1["locus"] == "TRB"][ "umi_count" ].astype(int) ) vdj_locus_p_trd_count = dict( data1[data1["locus"] == "TRD"][ "umi_count" ].astype(int) ) vdj_locus_c_trb_count = dict( data1[data1["locus"] == "TRB"][ "consensus_count" ].astype(int) ) vdj_locus_c_trd_count = dict( data1[data1["locus"] == "TRD"][ "consensus_count" ].astype(int) ) if len(vdj_locus_p_trb_count) > 1: ( keep_trb, extra_trb, ambiguous_trb, ) = check_productive_chain( umi_counts=vdj_locus_p_trb_count, consensus_counts=vdj_locus_c_trb_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: keep_trb, extra_trb, ambiguous_trb = ( [], [], [], ) if len(vdj_locus_p_trd_count) > 1: ( keep_trd, extra_trd, ambiguous_trd, ) = check_productive_chain( umi_counts=vdj_locus_p_trd_count, consensus_counts=vdj_locus_c_trd_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: keep_trd, extra_trd, ambiguous_trd = ( [], [], [], ) vdj_p = keep_trb + keep_trd extra_vdj = extra_trb + extra_trd ambiguous_vdj = ( ambiguous_trb + ambiguous_trd ) else: vdj_ccall_p_count = dict( data1["umi_count"].astype(int) ) vdj_ccall_c_count = dict( data1["consensus_count"].astype(int) ) if len(vdj_ccall_p_count) > 1: ( vdj_p, extra_vdj, ambiguous_vdj, ) = check_productive_chain( umi_counts=vdj_ccall_p_count, consensus_counts=vdj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: vdj_p, extra_vdj, ambiguous_vdj = ( [], [], [], ) else: vdj_ccall_p_count = dict( data1["umi_count"].astype(int) ) vdj_ccall_c_count = dict( data1["consensus_count"].astype(int) ) if len(vdj_ccall_p_count) > 1: ( vdj_p, extra_vdj, ambiguous_vdj, ) = check_productive_chain( umi_counts=vdj_ccall_p_count, consensus_counts=vdj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) else: vdj_ccall_p_count = dict( data1["umi_count"].astype(int) ) vdj_ccall_c_count = dict( data1["consensus_count"].astype(int) ) if len(vdj_ccall_p_count) > 1: ( vdj_p, extra_vdj, ambiguous_vdj, ) = check_productive_chain( umi_counts=vdj_ccall_p_count, consensus_counts=vdj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) if "ambiguous_vdj" not in locals(): ambiguous_vdj = [] if len(ambiguous_vdj) > 0: for a in ambiguous_vdj: self.ambiguous_contigs.append(a) else: data1 = None vdj_p = [] # VDJ non-productive if len(self.Cell[cell]["VDJ"]["NP"]) > 0: data2 = pd.DataFrame( [ self.Cell[cell]["VDJ"]["NP"][x] for x in self.Cell[cell]["VDJ"]["NP"] if isinstance(self.Cell[cell]["VDJ"]["NP"][x], dict) ], index=[ self.Cell[cell]["VDJ"]["NP"][x]["sequence_id"] for x in self.Cell[cell]["VDJ"]["NP"] if isinstance(self.Cell[cell]["VDJ"]["NP"][x], dict) ], ) vdj_np = list(data2["sequence_id"]) if len(vdj_np) > 1: if "sequence_alignment" in data2: ( data2, vdj_np, _, _, umi_adjust_vdjnp, ambi_cont_vdjnp, ) = check_update_same_seq(data2) if len(umi_adjust_vdjnp) > 0: self.umi_adjustment.update(umi_adjust_vdjnp) if len(ambi_cont_vdjnp) > 0: for avdj in ambi_cont_vdjnp: self.ambiguous_contigs.append(avdj) if len(vdj_np) > 1: vdj_ccall_np_count = dict( data2["umi_count"].astype(int) ) vdj_ccall_c_count = dict( data2["consensus_count"].astype(int) ) if len(vdj_ccall_np_count) > 1: vdj_np, extra_vdjnp, ambiguous_vdjnp = ( check_productive_chain( umi_counts=vdj_ccall_np_count, consensus_counts=vdj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vdj, ) ) if len(ambiguous_vdjnp) > 0: for a in ambiguous_vdjnp: self.ambiguous_contigs.append(a) else: data2 = None vdj_np = [] # VJ productive if len(self.Cell[cell]["VJ"]["P"]) > 0: data3 = pd.DataFrame( [ self.Cell[cell]["VJ"]["P"][x] for x in self.Cell[cell]["VJ"]["P"] if isinstance(self.Cell[cell]["VJ"]["P"][x], dict) ], index=[ self.Cell[cell]["VJ"]["P"][x]["sequence_id"] for x in self.Cell[cell]["VJ"]["P"] if isinstance(self.Cell[cell]["VJ"]["P"][x], dict) ], ) vj_p = list(data3["sequence_id"]) if len(vj_p) > 1: if "sequence_alignment" in data3: ( data3, vj_p, _, _, umi_adjust_vj, ambi_cont_vj, ) = check_update_same_seq(data3) if len(umi_adjust_vj) > 0: self.umi_adjustment.update(umi_adjust_vj) if len(ambi_cont_vj) > 0: for avj in ambi_cont_vj: self.ambiguous_contigs.append(avj) if len(vj_p) > 1: vj_ccall_p_count = dict(data3["umi_count"].astype(int)) vj_ccall_c_count = dict( data3["consensus_count"].astype(int) ) vj_p, extra_vj, ambiguous_vj = check_productive_chain( umi_counts=vj_ccall_p_count, consensus_counts=vj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vj, # maximum keep 2 as default? ) if "ambiguous_vj" not in locals(): ambiguous_vj = [] if len(ambiguous_vj) > 0: for a in ambiguous_vj: self.ambiguous_contigs.append(a) else: data3 = None vj_p = [] # VJ non-productive if len(self.Cell[cell]["VJ"]["NP"]) > 0: data4 = pd.DataFrame( [ self.Cell[cell]["VJ"]["NP"][x] for x in self.Cell[cell]["VJ"]["NP"] if isinstance(self.Cell[cell]["VJ"]["NP"][x], dict) ], index=[ self.Cell[cell]["VJ"]["NP"][x]["sequence_id"] for x in self.Cell[cell]["VJ"]["NP"] if isinstance(self.Cell[cell]["VJ"]["NP"][x], dict) ], ) vj_np = list(data4["sequence_id"]) if len(vj_np) > 1: # pragma: no cover if "sequence_alignment" in data4: ( data4, vj_np, _, _, umi_adjust_vjnp, ambi_cont_vjnp, ) = check_update_same_seq(data4) if len(umi_adjust_vjnp) > 0: self.umi_adjustment.update(umi_adjust_vjnp) if len(ambi_cont_vjnp) > 0: for avj in ambi_cont_vjnp: self.ambiguous_contigs.append(avj) if len(vj_np) > 1: vj_ccall_np_count = dict(data4["umi_count"].astype(int)) vj_ccall_c_count = dict( data4["consensus_count"].astype(int) ) if len(vj_ccall_np_count) > 1: vj_np, extra_vjnp, ambiguous_vjnp = ( check_productive_chain( umi_counts=vj_ccall_np_count, consensus_counts=vj_ccall_c_count, umi_foldchange_cutoff=umi_foldchange_cutoff, consensus_foldchange_cutoff=consensus_foldchange_cutoff, ntop=ntop_vj, ) ) if len(ambiguous_vjnp) > 0: for a in ambiguous_vjnp: self.ambiguous_contigs.append(a) else: data4 = None vj_np = [] extra_vdj_ = mark_ntop_contigs( productive_data=data1, nonproductive_data=data2, productive_contig=vdj_p, nonproductive_contig=vdj_np, ntop=ntop_vdj, ) for ex in extra_vdj_: self.extra_contigs.append(ex) extra_vj_ = mark_ntop_contigs( productive_data=data3, nonproductive_data=data4, productive_contig=vj_p, nonproductive_contig=vj_np, ntop=ntop_vj, ) for ex in extra_vj_: self.extra_contigs.append(ex) if "vdj_p" not in locals(): vdj_p = [] if "vj_p" not in locals(): vj_p = [] if "vdj_np" not in locals(): vdj_np = [] if "vj_np" not in locals(): vj_np = [] if "extra_vdj" not in locals(): extra_vdj = [] if "extra_vj" not in locals(): extra_vj = [] if "extra_vdjnp" not in locals(): extra_vdjnp = [] if "extra_vjnp" not in locals(): extra_vjnp = [] # check here for bad combinations # marking poor bcr quality, defined as those with conflicting assignment of # locus and V(D)J v-, d-, j- and c- calls, and also those that are missing # j calls. if len(vdj_p) > 0: for vdjx in vdj_p: v = v_dict[vdjx] d = d_dict[vdjx] j = j_dict[vdjx] c = c_dict[vdjx] if present(v): if not re.search("IGH|TR[BD]|TRAV.*/DV", v): self.ambiguous_contigs.append(vdjx) if present(d): if not re.search("IGH|TR[BD]", d): self.ambiguous_contigs.append(vdjx) if present(j): if not re.search("IGH|TR[BD]", j): self.ambiguous_contigs.append(vdjx) if present(c): if not re.search("IGH|TR[BD]", c): self.ambiguous_contigs.append(vdjx) if present(j): if present(v): if not_same_call(v, j, "IGH"): self.ambiguous_contigs.append(vdjx) elif not_same_call(v, j, "TRB"): self.ambiguous_contigs.append(vdjx) elif not_same_call(v, j, "TRD"): if not re.search("TRAV.*/DV", v): self.ambiguous_contigs.append(vdjx) if present(d): if not_same_call(d, j, "IGH"): self.ambiguous_contigs.append(vdjx) elif not_same_call(d, j, "TRB"): self.ambiguous_contigs.append(vdjx) elif not_same_call(d, j, "TRD"): self.ambiguous_contigs.append(vdjx) else: self.ambiguous_contigs.append(vdjx) if len(vdj_np) > 0: for vdjx in vdj_np: v = v_dict[vdjx] d = d_dict[vdjx] j = j_dict[vdjx] c = c_dict[vdjx] if present(v): if not re.search("IGH|TR[BD]|TRAV.*/DV", v): self.ambiguous_contigs.append(vdjx) if present(d): if not re.search("IGH|TR[BD]", d): self.ambiguous_contigs.append(vdjx) if present(j): if not re.search("IGH|TR[BD]", j): self.ambiguous_contigs.append(vdjx) if present(c): if not re.search("IGH|TR[BD]", c): self.ambiguous_contigs.append(vdjx) if present(j): if present(v): if not_same_call(v, j, "IGH"): self.ambiguous_contigs.append(vdjx) elif not_same_call(v, j, "TRB"): self.ambiguous_contigs.append(vdjx) elif not_same_call(v, j, "TRD"): if not re.search("TRAV.*/DV", v): self.ambiguous_contigs.append(vdjx) if present(d): if not_same_call(d, j, "IGH"): self.ambiguous_contigs.append(vdjx) elif not_same_call(d, j, "TRB"): self.ambiguous_contigs.append(vdjx) elif not_same_call(d, j, "TRD"): self.ambiguous_contigs.append(vdjx) else: self.ambiguous_contigs.append(vdjx) if len(vj_p) > 0: for vjx in vj_p: v = v_dict[vjx] j = j_dict[vjx] c = c_dict[vjx] if present(v): if re.search("IGH|TRB", v): self.ambiguous_contigs.append(vjx) if present(j): if re.search("IGH|TRB", j): self.ambiguous_contigs.append(vjx) if present(c): if re.search("IGH|TRB", c): self.ambiguous_contigs.append(vjx) if present(j): if present(v): if not_same_call(v, j, "IGK"): self.ambiguous_contigs.append(vjx) elif not_same_call(v, j, "IGL"): self.ambiguous_contigs.append(vjx) elif not_same_call(v, j, "TRA"): if not re.search("TR[AD]", v): if not re.search("TRA", j): self.ambiguous_contigs.append(vjx) elif not_same_call(v, j, "TRG"): self.ambiguous_contigs.append(vjx) else: self.ambiguous_contigs.append(vjx) if len(vj_np) > 0: for vjx in vj_np: v = v_dict[vjx] j = j_dict[vjx] c = c_dict[vjx] if present(v): if re.search("IGH|TRB", v): self.ambiguous_contigs.append(vjx) if present(j): if re.search("IGH|TRB", j): self.ambiguous_contigs.append(vjx) if present(c): if re.search("IGH|TRB", c): self.ambiguous_contigs.append(vjx) if present(j): if present(v): if not_same_call(v, j, "IGK"): self.ambiguous_contigs.append(vjx) elif not_same_call(v, j, "IGL"): self.ambiguous_contigs.append(vjx) elif not_same_call(v, j, "TRA"): if not re.search("TR[AD]", v): if not re.search("TRA", j): self.ambiguous_contigs.append(vjx) elif not_same_call(v, j, "TRG"): self.ambiguous_contigs.append(vjx) else: self.ambiguous_contigs.append(vjx) if len(extra_vdj) > 0: for evdj in extra_vdj: v = v_dict[evdj] d = d_dict[evdj] j = j_dict[evdj] c = c_dict[evdj] if present(v): if not re.search("IGH|TR[BD]|TRAV.*/DV", v): self.ambiguous_contigs.append(evdj) if present(d): if not re.search("IGH|TR[BD]", d): self.ambiguous_contigs.append(evdj) if present(j): if not re.search("IGH|TR[BD]", j): self.ambiguous_contigs.append(evdj) if present(c): if not re.search("IGH|TR[BD]", c): self.ambiguous_contigs.append(evdj) if present(j): if present(v): if not_same_call(v, j, "IGH"): self.ambiguous_contigs.append(evdj) elif not_same_call(v, j, "TRB"): self.ambiguous_contigs.append(evdj) elif not_same_call(v, j, "TRD"): if not re.search("TRAV.*/DV", v): self.ambiguous_contigs.append(evdj) if present(d): if not_same_call(d, j, "IGH"): self.ambiguous_contigs.append(evdj) elif not_same_call(d, j, "TRB"): self.ambiguous_contigs.append(evdj) elif not_same_call(d, j, "TRD"): self.ambiguous_contigs.append(evdj) else: self.ambiguous_contigs.append(evdj) self.extra_contigs.append(evdj) if len(extra_vdjnp) > 0: for evdj in extra_vdjnp: v = v_dict[evdj] d = d_dict[evdj] j = j_dict[evdj] c = c_dict[evdj] if present(v): if not re.search("IGH|TR[BD]|TRAV.*/DV", v): self.ambiguous_contigs.append(evdj) if present(d): if not re.search("IGH|TR[BD]", d): self.ambiguous_contigs.append(evdj) if present(j): if not re.search("IGH|TR[BD]", j): self.ambiguous_contigs.append(evdj) if present(c): if not re.search("IGH|TR[BD]", c): self.ambiguous_contigs.append(evdj) if present(j): if present(v): if not_same_call(v, j, "IGH"): self.ambiguous_contigs.append(evdj) elif not_same_call(v, j, "TRB"): self.ambiguous_contigs.append(evdj) elif not_same_call(v, j, "TRD"): if not re.search("TRAV.*/DV", v): self.ambiguous_contigs.append(evdj) if present(d): if not_same_call(d, j, "IGH"): self.ambiguous_contigs.append(evdj) elif not_same_call(d, j, "TRB"): self.ambiguous_contigs.append(evdj) elif not_same_call(d, j, "TRD"): self.ambiguous_contigs.append(evdj) else: self.ambiguous_contigs.append(evdj) self.extra_contigs.append(evdj) if len(extra_vj) > 0: for evj in extra_vj: v = v_dict[evj] j = j_dict[evj] c = c_dict[evj] if present(v): if re.search("IGH|TRB", v): self.ambiguous_contigs.append(evj) if present(j): if re.search("IGH|TRB", j): self.ambiguous_contigs.append(evj) if present(c): if re.search("IGH|TRB", c): self.ambiguous_contigs.append(evj) if present(j): if present(v): if not_same_call(v, j, "IGK"): self.ambiguous_contigs.append(evj) elif not_same_call(v, j, "IGL"): self.ambiguous_contigs.append(evj) elif not_same_call(v, j, "TRA"): if not re.search("TR[AD]", v): if not re.search("TRA", j): self.ambiguous_contigs.append(evj) elif not_same_call(v, j, "TRG"): self.ambiguous_contigs.append(evj) self.extra_contigs.append(evj) if len(extra_vjnp) > 0: # pragma: no cover for evj in extra_vjnp: v = v_dict[evj] j = j_dict[evj] c = c_dict[evj] if present(v): if re.search("IGH|TRB", v): self.ambiguous_contigs.append(evj) if present(j): if re.search("IGH|TRB", j): self.ambiguous_contigs.append(evj) if present(c): if re.search("IGH|TRB", c): self.ambiguous_contigs.append(evj) if present(j): if present(v): if not_same_call(v, j, "IGK"): self.ambiguous_contigs.append(evj) elif not_same_call(v, j, "IGL"): self.ambiguous_contigs.append(evj) elif not_same_call(v, j, "TRA"): if not re.search("TR[AD]", v): if not re.search("TRA", j): self.ambiguous_contigs.append(evj) elif not_same_call(v, j, "TRG"): self.ambiguous_contigs.append(evj) self.extra_contigs.append(evj) def check_productive_chain( umi_counts: dict[str, int], consensus_counts: dict[str, int], umi_foldchange_cutoff: int | float, consensus_foldchange_cutoff: int | float, ntop: int, ) -> tuple[list[str], list[str], list[str]]: """ Function to keep top two productive vj chains because of allelic inclusions. Parameters ---------- umi_counts : dict[str, int] dictionary of contigs with umi count. consensus_counts : dict[str, int] dictionary of contigs with consensus count. umi_foldchange_cutoff : int | float fold-change cut off for decision for umi count. consensus_foldchange_cutoff : int | float fold-change cut off for decision for consensus count. ntop : int number of top contigs to keep. Returns ------- tuple[list[str], list[str], list[str]] lists of contigs to keep, are extra or are ambiguous. """ keep_contigs, extra_contigs, ambiguous_contigs = [], [], [] # Look at all the contigs, assessing if their umi counts are >= cutoff compared to the lowest umi count or 3, whichever is lower. # if none pass the cutoff, then mark all as ambiguous # Allow up to two to pass the cutoff, keep those two contigs, and the rest that pass the cut off in the extra contigs, and mark the rest as ambiguous # If there are ties in the umi counts, then look at the consensus counts to break the tie using the same logic as above, but with a cutoff of 5. min_umi_count, min_con_count = min(min(umi_counts.values()), 3), min( min(consensus_counts.values()), 5 ) # test the umi fold change umi_test = { k: ( ((umi_counts[k] / min_umi_count) >= umi_foldchange_cutoff) & (umi_counts[k] >= 3) ) for k in umi_counts } # test the consensus fold change con_test = { k: ( ( (consensus_counts[k] / min_con_count) >= consensus_foldchange_cutoff ) & (consensus_counts[k] >= 5) ) for k in consensus_counts } filtered_contigs = {k: v for k, v in umi_counts.items() if umi_test[k]} if any(umi_test.values()): # get the top n contigs if len(filtered_contigs) <= ntop: keep_contigs.extend(list(filtered_contigs.keys())) failed_contigs = { k: v for k, v in umi_counts.items() if not umi_test[k] } ambiguous_contigs.extend(list(failed_contigs.keys())) else: # check the consensus fold change if any(con_test.values()): keep_contigs, extra_contigs, ambiguous_contigs = ( keep_if_consensus_count_is_high( filtered_contigs=filtered_contigs, umi_counts=umi_counts, consensus_counts=consensus_counts, keep_contigs=keep_contigs, extra_contigs=extra_contigs, ambiguous_contigs=ambiguous_contigs, consensus_test=con_test, ntop=ntop, ) ) else: # not enough counts to confidently classify ambiguous_contigs.extend(list(umi_counts.keys())) else: if any(con_test.values()): keep_contigs, extra_contigs, ambiguous_contigs = ( keep_if_consensus_count_is_high( filtered_contigs=filtered_contigs, umi_counts=umi_counts, consensus_counts=consensus_counts, keep_contigs=keep_contigs, extra_contigs=extra_contigs, ambiguous_contigs=ambiguous_contigs, consensus_test=con_test, ntop=ntop, ) ) else: # Not enough counts to confidently classify ambiguous_contigs.extend(umi_counts.keys()) return keep_contigs, extra_contigs, ambiguous_contigs def keep_if_consensus_count_is_high( filtered_contigs: dict[str, int], umi_counts: dict[str, int], consensus_counts: dict[str, int], keep_contigs: list[str], extra_contigs: list[str], ambiguous_contigs: list[str], consensus_test: dict[str, bool], ntop: int, ) -> tuple[list[str], list[str], list[str]]: """Accessories function to keep the contigs based on consensus counts.""" # sort the umi counts and use the consensus counts to break the tie sorted_contigs = dict( sorted( umi_counts.items(), key=lambda k: (k[1], consensus_counts[k[0]]), reverse=True, ) ) # get the top 2 contigs _keep = list(sorted_contigs.keys())[:ntop] _keep_filtered = [k for k in _keep if consensus_test[k]] # get the extras _extra = [k for k in filtered_contigs if k not in _keep_filtered] # get the ambiguous _ambi = list({k for k in umi_counts if k not in _keep_filtered + _extra}) # extend the lists keep_contigs.extend(_keep_filtered) # get the extra contigs extra_contigs.extend(_extra) # get the ambiguous contigs ambiguous_contigs.extend(_ambi) return keep_contigs, extra_contigs, ambiguous_contigs def check_update_same_seq( data: pd.DataFrame, ) -> tuple[ pd.DataFrame, list[str], list[int], list[str], dict[str, int], list[str] ]: """Check if sequences are the same. Parameters ---------- data : pd.DataFrame AIRR data frame in Dandelion.data. Returns ------- tuple[pd.DataFrame, list[str], list[int], list[str], dict[str, int], list[str]] updated AIRR data frame, lists of contigs to keep, their umi counts, their c_calls, adjusted umi counts, and list of ambiguous contigs. """ keep_id = [] keep_ccall = [] umi_adjust = {} ambi_cont = [] sequencecol = ( "sequence_alignment" if "sequence_alignment" in data else "sequence" ) if sequencecol in data: seq_ = list(data[sequencecol]) seq_2 = [s for s in seq_ if present(s)] if len(set(seq_2)) < len(seq_2): _seq = { k: r for k, r in dict(data[sequencecol]).items() if present(r) } _count = { k: r for k, r in dict(data.umi_count.astype(int)).items() if k in _seq } rep_seq = [ seq for seq in set(_seq.values()) if countOf(_seq.values(), seq) > 1 ] keep_seqs = [ seq for seq in set(_seq.values()) if countOf(_seq.values(), seq) == 1 ] keep_seqs_ids = [i for i, seq in _seq.items() if seq in keep_seqs] if len(rep_seq) > 0: for rep in rep_seq: dup_keys = [k for k, v in _seq.items() if v == rep] keep_index_vj = dup_keys[0] keep_index_count = int(_count[keep_index_vj]) sum_rep_counts = np.sum([_count[k] for k in dup_keys[1:]]) umi_adjust.update( { keep_index_vj: int( np.sum( [ sum_rep_counts, keep_index_count, ], ) ) } ) for dk in dup_keys[1:]: ambi_cont.append(dk) keep_seqs_ids.append(keep_index_vj) if keep_index_vj in data.index: data.at[keep_index_vj, "umi_count"] = keep_index_count # refresh empty_seqs_ids = [ k for k, r in dict(data[sequencecol]).items() if not present(r) ] if len(empty_seqs_ids) > 0: keep_seqs_ids = keep_seqs_ids + empty_seqs_ids data = data.loc[keep_seqs_ids] keep_id = list(data.sequence_id) keep_umi = [int(x) for x in pd.to_numeric(data.umi_count)] keep_ccall = list(data.c_call) else: keep_id = list(data.sequence_id) keep_umi = [int(x) for x in pd.to_numeric(data.umi_count)] keep_ccall = list(data.c_call) return (data, keep_id, keep_umi, keep_ccall, umi_adjust, ambi_cont) def choose_segments( starts: pd.Series, ends: pd.Series, scores: pd.Series ) -> list[str]: """Choose left most segment Parameters ---------- starts : pd.Series nucleotide start positions. ends : pd.Series nucleotide end positions. scores : pd.Series alignment scores. Returns ------- list[str] list of chosen segments. """ starts = np.array(starts) ends = np.array(ends) scores = np.array(scores) ind = np.arange(len(starts)) chosen = [] while len(ind) > 0: best = np.argmax(scores) chosen.append(ind[best]) overlap = (starts <= ends[best]) & (ends >= starts[best]) ind = ind[~overlap] starts = starts[~overlap] ends = ends[~overlap] scores = scores[~overlap] return chosen def multimapper(filename: str) -> pd.DataFrame: """Select the left more segment as the final call Parameters ---------- filename : str path to multimapper file. Returns ------- pd.DataFrame Mapped multimapper data frame. """ df = pd.read_csv(filename, delimiter="\t") df_new = df.loc[ df["j_support"] < 1e-3, : ] # maybe not needing to filter if j_support has already been filtered tmp = pd.DataFrame( index=list(set(df_new["sequence_id"])), columns=[ "multimappers", "multiplicity", "sequence_start_multimappers", "sequence_end_multimappers", "support_multimappers", ], ) # Define a function to apply to each group def process_group(group: pd.DataFrame) -> pd.Series: """ Create a dictionary for the multimappers results. Parameters ---------- group : pd.DataFrame input dataframe for a given sequence_id. Returns ------- pd.Series A pandas series with the multimappers results. """ starts = group["j_sequence_start"] ends = group["j_sequence_end"] scores = -group["j_support"] chosen_ind = choose_segments(starts, ends, scores) group = group.iloc[chosen_ind, :] group = group.sort_values(by=["j_sequence_start"], ascending=True) return pd.Series( { "multimappers": json.dumps(list(group["j_call"])), "multiplicity": group.shape[0], "sequence_start_multimappers": json.dumps( list(group["j_sequence_start"]) ), "sequence_end_multimappers": json.dumps( list(group["j_sequence_end"]) ), "support_multimappers": json.dumps(list(group["j_support"])), } ) # Group by "sequence_id" and apply the processing function, then reset the index mapped = df_new.groupby("sequence_id").apply(process_group).reset_index() # Set the index explicitly mapped.set_index("sequence_id", drop=True, inplace=True) # change multiplicity to integer mapped["multiplicity"] = mapped["multiplicity"].astype("Int64") mapped = mapped.reindex(tmp.index) return mapped def update_j_multimap(data: list[str], filename_prefix: list[str]): """Update j multimapper call. Parameters ---------- data : list[str] input folders. filename_prefix : list[str] prefixes to append to front of files. """ if not isinstance(data, list): data = [data] if not isinstance(filename_prefix, list): filename_prefix = [filename_prefix] for i in range(0, len(data)): filePath0 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_j_blast.tsv", sub_dir="tmp", ) filePath1 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-pass.tsv", sub_dir="tmp", ) filePath1g = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-pass_genotyped.tsv", sub_dir="tmp", ) filePath2 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-all.tsv", sub_dir="tmp", ) filePath3 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-fail.tsv", sub_dir="tmp", ) filePath4 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_dandelion.tsv", ) jmm_transfer_cols = [ "multimappers", "multiplicity", "sequence_start_multimappers", "sequence_end_multimappers", "support_multimappers", ] check_multimapper(filePath0, filePath2) if filePath0 is not None: jmulti = multimapper(filePath0) if filePath1 is not None: dbpass = load_data(filePath1) for col in jmm_transfer_cols: update_j_col_df(dbpass, jmulti, col) write_airr(dbpass, filePath1) if filePath1g is not None: dbpassg = load_data(filePath1g) for col in jmm_transfer_cols: update_j_col_df(dbpassg, jmulti, col) write_airr(dbpassg, filePath1g) if filePath2 is not None: dbfail = load_data(filePath2) for col in jmm_transfer_cols: update_j_col_df(dbfail, jmulti, col) for i in dbfail.index: if not present(dbfail.loc[i, "v_call"]): jmmappers = safe_json_load( dbfail.at[i, "j_call_multimappers"] ) jmmappersstart = safe_json_load( dbfail.at[i, "j_call_sequence_start_multimappers"] ) jmmappersend = safe_json_load( dbfail.at[i, "j_call_sequence_end_multimappers"] ) jmmapperssupport = safe_json_load( dbfail.at[i, "j_call_support_multimappers"] ) if len(jmmappers) > 1: dbfail.at[i, "j_call"] = jmmappers[0] dbfail.at[i, "j_sequence_start"] = float( jmmappersstart[0] ) dbfail.at[i, "j_sequence_end"] = float( jmmappersend[0] ) dbfail.at[i, "j_support"] = float( jmmapperssupport[0] ) write_airr(dbfail, filePath2) if filePath3 is not None: dball = load_data(filePath3) for col in jmm_transfer_cols: update_j_col_df(dball, jmulti, col) for i in dball.index: if not present(dball.loc[i, "v_call"]): jmmappers = safe_json_load( dball.at[i, "j_call_multimappers"] ) jmmappersstart = safe_json_load( dball.at[i, "j_call_sequence_start_multimappers"] ) jmmappersend = safe_json_load( dball.at[i, "j_call_sequence_end_multimappers"] ) jmmapperssupport = safe_json_load( dball.at[i, "j_call_support_multimappers"] ) if len(jmmappers) > 1: dball.at[i, "j_call"] = jmmappers[0] dball.at[i, "j_sequence_start"] = float( jmmappersstart[0] ) dball.at[i, "j_sequence_end"] = float( jmmappersend[0] ) dball.at[i, "j_support"] = float( jmmapperssupport[0] ) write_airr(dball, filePath3) if filePath4 is not None: dandy = load_data(filePath4) for col in jmm_transfer_cols: update_j_col_df(dandy, jmulti, col) write_airr(dandy, filePath4) def check_multimapper( filename1: str, filename2: str, ) -> pd.DataFrame: """Select the left more segment as the final call Parameters ---------- filename1 : str path to multimapper file. filename2 : str path to reference file containing all information. Returns ------- None Writes the filtered multimapper data back to ``filename1`` in-place. """ if filename1 is not None: if filename2 is not None: df = pd.read_csv(filename1, sep="\t") df_new = df[ df["j_support"] < 1e-3 ] # maybe not needing to filter if j_support has already been filtered df_ref = load_data(filename2) mapped = list(set(df_new["sequence_id"])) keep = [] for j in mapped: tmp = df_new[df_new["sequence_id"] == j][ [ "j_sequence_start", "j_sequence_end", "j_support", "j_call", ] ] if j in df_ref.index: vend = df_ref.loc[j, "v_sequence_end"] vend_ = 0 if not present(vend) else vend for i in tmp.index: callstart = tmp.loc[i, "j_sequence_start"] if callstart >= vend_: keep.append(i) keepdf = df_new.loc[keep] keepdf.to_csv(filename1, sep="\t", index=False) def update_j_col_df(airrdata: pd.DataFrame, jmulti: pd.DataFrame, col: str): """ Update the j_call column in the dataframe with the values from the jmulti dataframe without triggering future warning. Parameters ---------- airrdata : pd.DataFrame The airr dataframe to update. jmulti : pd.DataFrame The jmulti dataframe to update from. col : str The column to update. """ airrdata["j_call_" + col] = "" df = pd.DataFrame(index=airrdata.index) df[col] = "" df.update(jmulti[[col]]) df["j_call_" + col] = df[col] df = df[["j_call_" + col]] airrdata.update(df[["j_call_" + col]]) if col == "multiplicity": airrdata["j_call_" + col] = airrdata["j_call_" + col].replace("", 0) airrdata["j_call_" + col] = sanitize_column( airrdata["j_call_" + col], "integer" ) def mark_ntop_contigs( productive_data: pd.DataFrame | None, nonproductive_data: pd.DataFrame | None, productive_contig: list[str], nonproductive_contig: list[str], ntop: int, ) -> list[str]: """ Function to mark the not top contigs based on umi count and productive status. Parameters ---------- productive_data : pd.DataFrame dataframe containing productive contigs. nonproductive_data : pd.DataFrame dataframe containing nonproductive contigs. productive_contig : list[str] filtered productive contigs. nonproductive_contig : list[str] filtered nonproductive contigs. ntop : int number of top contigs to keep. Returns ------- list[str] list of additional contigs that are not in the top ntop contigs to mark as extra. """ additional_extras = [] if productive_data is not None: if nonproductive_data is not None: data_concat = pd.concat([productive_data, nonproductive_data]) else: data_concat = productive_data else: if nonproductive_data is not None: data_concat = nonproductive_data else: return additional_extras # sort by productive and then by umi count data_concat = data_concat.sort_values( ["productive", "umi_count"], ascending=[False, False] ) # keep only the top ntop contigs data_concat = data_concat.head(ntop) # any contigs not found in data_concat are extra if len(productive_contig) > 0: for contig in productive_contig: if contig not in data_concat["sequence_id"]: additional_extras.append(contig) if len(nonproductive_contig) > 0: for contig in nonproductive_contig: if contig not in data_concat["sequence_id"]: additional_extras.append(contig) return additional_extras def mask_dj( data: list[Path | str], filename_prefix: str, d_evalue_threshold: float, j_evalue_threshold: float, ) -> None: """Mask d/j assignment. Parameters ---------- data : list[Path | str] list of paths to data folders. filename_prefix : list[str] list of prefixes of file names preceding '_contig'. d_evalue_threshold : float e-value threshold above which d_call is cleared. j_evalue_threshold : float e-value threshold above which j_call is cleared. """ for i in range(0, len(data)): filePath = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-pass.tsv", ) if filePath is not None: dat = load_data(filePath) if "d_support_blastn" in dat: dat["d_call"] = [ "" if s > d_evalue_threshold else c for c, s in zip(dat["d_call"], dat["d_support_blastn"]) ] if "j_support_blastn" in dat: dat["j_call"] = [ "" if s > j_evalue_threshold else c for c, s in zip(dat["j_call"], dat["j_support_blastn"]) ] write_airr(dat, filePath) def change_file_location( data: list[Path | str], filename_prefix: list[str] | str | None = None, ) -> None: """ Move file from tmp folder to dandelion folder. Only used for TCR data. Parameters ---------- data : list[Path | str] list of data folders containing the .tsv files. if provided as a single string, it will first be converted to a list; this allows for the function to be run on single/multiple samples. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. None defaults to 'all'. """ fileformat = "blast" data, filename_prefix = check_data(data, filename_prefix) informat_dict = { "changeo": "_igblast_db-pass.tsv", "blast": "_igblast_db-pass.tsv", "airr": "_igblast_gap.tsv", } filePath = None for i in range(0, len(data)): filePath = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with=informat_dict[fileformat], sub_dir="tmp", ) if filePath is not None: tmp = load_data(filePath) tmp = check_travdv(tmp) _airrfile = str(filePath).replace("_db-pass.tsv", ".tsv") airr_output = load_data(_airrfile) cols_to_merge = [ "junction_aa_length", "fwr1_aa", "fwr2_aa", "fwr3_aa", "fwr4_aa", "cdr1_aa", "cdr2_aa", "cdr3_aa", "sequence_alignment_aa", "v_sequence_alignment_aa", "d_sequence_alignment_aa", "j_sequence_alignment_aa", ] for x in cols_to_merge: tmp[x] = pd.Series(airr_output[x]) write_airr(tmp, filePath) fp = Path(filePath) shutil.copyfile(fp, fp.parent.parent / fp.name) def move_to_tmp( data: list[Path | str], filename_prefix: list[str] | str | None = None ) -> None: """Move file to tmp. Parameters ---------- data : list[Path | str] list of paths to data folders. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. ``None`` defaults to 'all'. """ data, filename_prefix = check_data(data, filename_prefix) for i in range(0, len(data)): filePath1 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_annotations.csv", ) filePath2 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with=".fasta" ) for fp in [filePath1, filePath2]: fp = Path(fp) shutil.move(fp, fp.parent / "tmp" / fp.name) def make_all( data: list[Path | str], filename_prefix: list[str] | str | None = None, loci: Literal["ig", "tr"] = "tr", ) -> None: """Construct db-all tsv file. Parameters ---------- data : list[Path | str] list of paths to data folders. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. ``None`` defaults to 'all'. loci : Literal["ig", "tr"], optional locus type determining which intermediate files to combine. """ data, filename_prefix = check_data(data, filename_prefix) for i in range(0, len(data)): if loci == "tr": filePath1 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-pass.tsv", sub_dir="tmp", ) else: filePath1 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-pass_genotyped.tsv", sub_dir="tmp", ) if filePath1 is None: filePath1 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-pass.tsv", sub_dir="tmp", ) out_ex = "db-pass.tsv" else: out_ex = "db-pass_genotyped.tsv" filePath2 = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with="_igblast_db-fail.tsv", sub_dir="tmp", ) if filePath1 is not None: df1 = pd.read_csv(filePath1, sep="\t") df1 = check_complete(df1) write_airr(df1, filePath1) if filePath2 is not None: df2 = pd.read_csv(filePath2, sep="\t") df2 = check_complete(df2) df = pd.concat([df1, df2]) if loci == "tr": write_airr( df, filePath1.parent / ( filePath1.name.rsplit("db-pass.tsv")[0] + "db-all.tsv" ), ) else: write_airr( df, filePath1.parent / (filePath1.name.rsplit(out_ex)[0] + "db-all.tsv"), ) write_airr(df2, filePath2) else: if loci == "tr": write_airr( df1, filePath1.parent / ( filePath1.name.rsplit("db-pass.tsv")[0] + "db-all.tsv" ), ) else: write_airr( df1, filePath1.parent / (filePath1.name.rsplit(out_ex)[0] + "db-all.tsv"), ) def rename_dandelion( data: list[Path | str], filename_prefix: list[str] | str | None = None, ends_with: str = "_igblast_db-pass_genotyped.tsv", sub_dir: str | None = None, ) -> None: """Rename final dandelion file. Parameters ---------- data : list[Path | str] list of paths to data folders. filename_prefix : list[str] | str | None, optional list of prefixes of file names preceding '_contig'. ``None`` defaults to 'all'. ends_with : str, optional suffix of the file to rename. sub_dir : str | None, optional sub-directory to look in when searching for the file. """ data, filename_prefix = check_data(data, filename_prefix) for i in range(0, len(data)): filePath = check_filepath( data[i], filename_prefix=filename_prefix[i], ends_with=ends_with, sub_dir=sub_dir, ) # must be whatever's after contig if sub_dir is None: fp = filePath.parent / filePath.name.rsplit(ends_with)[0] else: fp = filePath.parent.parent / filePath.name.rsplit(ends_with)[0] shutil.move(filePath, Path(str(fp) + "_dandelion.tsv")) def check_complete(df: pd.DataFrame) -> pd.DataFrame: """check if contig contains cdr3. Parameters ---------- df : pd.DataFrame airr data frame. Returns ------- pd.DataFrame completed airr data frame """ if "complete_vdj" not in df: df["complete_vdj"] = "" for i in df.index: junc = df.loc[i, "junction"] if not present(junc): df.at[i, "productive"] = "F" df.at[i, "complete_vdj"] = "F" return df def safe_json_load(s: list | str | None) -> list: """Safely load json arrays.""" if not s: # empty string or None return [] # fallback empty list return json.loads(s)
[docs] def annotate_functionality( vdj: Dandelion, germline: Path | str | None = None, org: Literal["human", "mouse"] = "human", db: Literal["imgt", "ogrdb", "kiarva", "gkhlab"] = "imgt", ) -> Dandelion: """Annotate V/D/J gene functionality from germline reference FASTA headers. Parameters ---------- vdj : Dandelion Dandelion object containing AIRR-style calls in `.data`. germline : Path | str | None, optional Path to germline database root, `db/org`, or `db/org/vdj`. If None, resolves from the `GERMLINE` environment variable using IMGT defaults for the selected organism. org : Literal["human", "mouse"], optional Organism used when resolving default/reference directory layout. db : Literal["imgt", "ogrdb", "kiarva", "gkhlab"], optional Database to use. Defaults to "imgt". Returns ------- Dandelion The same `vdj` object with additional columns: `v_call_functionality`, `d_call_functionality`, and `j_call_functionality`. """ if not isinstance(vdj, Dandelion): raise TypeError("`vdj` must be a Dandelion object.") vdj_dir = _resolve_germline_vdj_dir(germline=germline, org=org, db=db) exact_map, no_allele_map = _load_germline_functionality_map(vdj_dir) dat = vdj.data.copy() for call_col in ["v_call", "d_call", "j_call"]: out_col = call_col.replace("_call", "_call_functionality") if call_col in dat.columns: dat[out_col] = dat[call_col].map( lambda x: _lookup_gene_functionality( gene_call=x, exact_map=exact_map, no_allele_map=no_allele_map, ) ) else: dat[out_col] = None vdj.data = dat return vdj