Pre-processing (Re-annotation)

Foreword

dandelion is written in Python 3 and is a single-cell BCR/TCR V(D)J-seq analysis package. For the pre-processing section, it integrates a standard pipeline for V(D)J gene reannotation with IgBLAST, similar to the fantastic immcantation suite [Gupta2015]. This work streamlines the pre-processing and exploratory stages for analyzing single-cell BCR/TCR V(D)J-seq data from 10X Genomics (and other technologies as long as they can be formatted or read into dandelion accordingly). Post-processed data from dandelion can be smoothly transferred to scirpySturm2020 and Scanpy/AnnData [Wolf2018] object for integration and exploration of scV(D)J-seq data and scRNA-seq data.

For some of the more advanced scV(D)J-seq analysis, specifically V(D)J trajectory analysis, there’s also an R package dandelionR Yu2024 available on GitHub and BioConductor. If you are an R user and you want to perform pre-processing and re-annotation of your single-cell V(D)J-seq data, please refer to the immcantation suite and its documentation. Alternatively, there is a singularity container that can automate the steps outlined below.

Note

This section will cover the initial pre-processing of files after 10X’s CellRanger vdj immune profiling data analysis (BCR) pipeline manually.

[1]:
# Import modules
import dandelion as ddl

# Set backend to "base" for the purpose of this tutorial as my environment already has polars installed so the default backend is polars. You can set the backend to "base" to use pandas instead.
ddl.set_backend("base")

ddl.logging.print_versions()
dandelion==1.0.0a1.dev36 pandas==2.3.3 numpy==2.3.5 matplotlib==3.10.6 networkx==3.6.1 scipy==1.15.2

We will download the 10X data sets to process for this tutorial. The following function will download the tutorial files and place them in a folder called dandelion_tutorial in your current working directory.

[2]:
# new function to setup tutorial data
from dandelion.tutorial import setup_dandelion_tutorial_bcr

setup_dandelion_tutorial_bcr()

# change to the tutorial data directory
import os

os.chdir("dandelion_tutorial")
Downloading filtered_feature_bc_matrix.h5 → dandelion_tutorial/vdj_v1_hs_pbmc3_b/filtered_feature_bc_matrix.h5
Downloading filtered_contig_annotations.csv → dandelion_tutorial/vdj_v1_hs_pbmc3_b/filtered_contig_annotations.csv
Downloading filtered_contig.fasta → dandelion_tutorial/vdj_v1_hs_pbmc3_b/filtered_contig.fasta
Downloading filtered_feature_bc_matrix.h5 → dandelion_tutorial/vdj_nextgem_hs_pbmc3_b/filtered_feature_bc_matrix.h5
Downloading filtered_contig_annotations.csv → dandelion_tutorial/vdj_nextgem_hs_pbmc3_b/filtered_contig_annotations.csv
Downloading filtered_contig.fasta → dandelion_tutorial/vdj_nextgem_hs_pbmc3_b/filtered_contig.fasta
Downloading filtered_feature_bc_matrix.h5 → dandelion_tutorial/sc5p_v2_hs_PBMC_10k_b/filtered_feature_bc_matrix.h5
Downloading filtered_contig_annotations.csv → dandelion_tutorial/sc5p_v2_hs_PBMC_10k_b/filtered_contig_annotations.csv
Downloading filtered_contig.fasta → dandelion_tutorial/sc5p_v2_hs_PBMC_10k_b/filtered_contig.fasta
Downloading airr_rearrangement.tsv → dandelion_tutorial/sc5p_v2_hs_PBMC_10k_b/airr_rearrangement.tsv
Downloading filtered_feature_bc_matrix.h5 → dandelion_tutorial/sc5p_v2_hs_PBMC_1k_b/filtered_feature_bc_matrix.h5
Downloading filtered_contig_annotations.csv → dandelion_tutorial/sc5p_v2_hs_PBMC_1k_b/filtered_contig_annotations.csv
Downloading filtered_contig.fasta → dandelion_tutorial/sc5p_v2_hs_PBMC_1k_b/filtered_contig.fasta

Dandelion’s reannotation workflow requires CellRanger formatted-files to start, particularly either all_contig.fasta or filtered_contig.fasta and corresponding all_contig_annotations.csv and filtered_contig_annotations.csv. If you only have an AIRR rearrangement file, you can still load it into dandelion and write the files out with .write_10x function later.

I’m running everything with the filtered files to speed up the tutorial but I would recommend starting with the all files as they contain more information, and it is easier to filter the contigs than to try and add them back in later.

If you followed the installation instructions, you should have the requisite auxillary softwares installed already. Otherwise, you can download them manually: blast+ and igblast.

For convenience, in shell, export the path to the database folders like as follows:

# ~/.bash_profile or ~/.bashrc if using bash or ~/.zshrc if you are using zsh
echo "export GERMLINE=$HOME/Documents/Github/dandelion/container/database/germlines/" >> ~/.bash_profile
echo "export IGDATA=$HOME/Documents/Github/dandelion/container/database/igblast/" >> ~/.bash_profile
echo "export BLASTDB=$HOME/Documents/Github/dandelion/container/database/blast/" >> ~/.bash_profile
source ~/.bash_profile

The databases for igblast are basically setup using changeo’s instructions.

If you are using a jupyter notebook initialized via jupyterhub instance, you might want to try the fix to a known issue where pathing requires some adjustments https://github.com/zktuong/dandelion/discussions/146.

For reannotation of constant genes, reference fasta files were downloaded from IMGT and only sequences corresponding to CH1 region for each constant gene/allele were retained. The headers were trimmed to only keep the gene and allele information. Links to find the sequences can be found here : human and mouse.

The utility function ddl.utl.makeblastdb is a wrapper for:

# bash/shell
makeblastdb -dbtype nucl -parse_seqids -in $BLASTDB/human/human_BCR_C.fasta

This does the same thing:

# python
ddl.utl.makeblastdb(os.path.expanduser("~/Documents/Github/dandelion/container/database/blast/human/human_BCR_C.fasta")

This section will now demonstrate how I batch process multiple samples/files from the same donor, as it will become important later on.

Finally, because you are running the preprocessing manually, you will need to install some R packages so that they work later:

install.packages(c("optparse", "airr", "shazam", "alakazam", "tigger"))

Step 1: Formatting the headers of the Cell Ranger fasta file

Here, I’m adding a prefix to the headers of each contig in the fasta files, via the function pp.format_fastas. The prefix is basically just the folder name, so in this case it’s: sc5p_v2_hs_PBMC_1k, sc5p_v2_hs_PBMC_10k, vdj_v1_hs_pbmc3 and vdj_nextgem_hs_pbmc3.

The function will also create sub-folders where a new fasta file and all subsequent files will be located. The function will also add the prefix to the corresponding annotation file automatically and create a copy in the same folder as the formatted fasta file.

This is to ensure that the barcodes are consistent throughout so as not to interfere with subsequent integration with the gene expression data, which will be covered in subsequent sections.

The file structure should look something like this later on if the settings are left as default. The tmp directory can be deleted once the initial preprocessing has completed.

sc5p_v2_hs_PBMC_1k
├── dandelion
│   ├── filtered_contig.fasta
│   ├── filtered_contig_annotations.csv
│   ├── filtered_contig_igblast_db-pass_genotyped.tsv
│   └── tmp
│       ├── filtered_contig_igblast.fmt7
│       ├── filtered_contig_igblast.tsv
│       ├── filtered_contig_igblast_db-pass.blastsummary.txt
│       ├── filtered_contig_igblast_db-pass.tsv
│       ├── filtered_contig_igblast_db-pass.xml
│       ├── filtered_contig_igblast_db-pass_genotyped.tsv
│       ├── filtered_contig_igblast_db-pass_heavy_parse-select.tsv
│       └── filtered_contig_igblast_db-pass_light_parse-select.tsv
├── filtered_contig.fasta
├── filtered_contig_annotations.csv
└── filtered_feature_bc_matrix.h5

The first option of pp.format_fastas accepts a list of the fasta file paths to reformat, or list of names of folders containing the fasta files; each folder should only contain 1 fasta file, and 1 contig_annotation.csv. Make sure there’s no hidden files and delete those if present.

You can provide prefixes and/or suffixes to add the the cell/contig barcodes as a list and they will be formatted accordingly. The prefixes/suffixes will be separated by an underscore (_) if left as default but that can be adjusted with the sep option.

If you choose not to provide a prefix/suffix, then the function will simply make a copy of the original files and place it in the dandelion sub-folders.

For more complex experimental setups, such as with data from multiplexed experiments, please contact me (z.tuong@uq.edu.au) and I can walk you through a slightly more advanced set up.

[3]:
# the first option is a list of fasta files to format and the second option is the list of prefix to add to each file.
samples = [
    "sc5p_v2_hs_PBMC_1k_b",
    "sc5p_v2_hs_PBMC_10k_b",
    "vdj_v1_hs_pbmc3_b",
    "vdj_nextgem_hs_pbmc3_b",
]
# because I'm using the 'filtered' files, i need to specify the filename_prefix
ddl.pp.format_fastas(samples, prefix=samples, filename_prefix="filtered")
Formatting fasta(s) : 100%|██████████| 4/4 [00:00<00:00,  7.55it/s]

Please specify the filename_prefix option for all preprocessing functions below (except for quantify_mutations).

For example, use filename_prefix="all" for all_contig.fasta, or filename_prefix=<insertprefix> for any files that are named <insertprefix>_contig.fasta.

If you are running more than 1 sample and if each filename prefix needs to be specified, filename_prefix in ddl.pp.format_fastas will accept a list of prefixes i.e. filename_prefix=['all', 'filtered', ...].

Step 2: Reannotate the V/D/J genes with igblastn

Like immcantation, we will reannotate the V(D)J genes with igblastn using the latest IMGT reference databases. Dandelion’s pp.reannotate_genes will use flavour="strict" to run igblastn, imposing lower e-value and higher D-penalty cut offs. The original behaviour i.e. with changeo’s AssignGenes.py, is toggled with flavour="original". Additionally, there is now an additional assign_dj option (default is True), which will use blastn to assign a stricter call for the D and J genes because igblastn can return random assignments if it cannot detect a V gene. In the tmp folder, there will also be a table where all alignments generated in this step will be shown. All the column headers are now adhering to the AIRR standard.

[4]:
ddl.pp.reannotate_genes(samples, filename_prefix="filtered")
Assigning genes :   0%|          | 0/4 [00:00<?, ?it/s]
         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:29:22 |Done                | 0.0 min

PROGRESS> 13:29:23 |####################| 100% (202) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 185
  FAIL> 17
   END> MakeDb

         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:29:24 |Done                | 0.0 min

PROGRESS> 13:29:25 |####################| 100% (202) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 185
  FAIL> 17
   END> MakeDb

Assigning genes :  25%|██▌       | 1/4 [00:15<00:45, 15.12s/it]
         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:30:14 |Done                | 0.0 min

PROGRESS> 13:30:15 |####################| 100% (2,601) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 2413
  FAIL> 188
   END> MakeDb

         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:30:16 |Done                | 0.0 min

PROGRESS> 13:30:17 |####################| 100% (2,601) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 2413
  FAIL> 188
   END> MakeDb

Assigning genes :  50%|█████     | 2/4 [01:10<01:17, 38.80s/it]
         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:30:55 |Done                | 0.0 min

PROGRESS> 13:30:56 |####################| 100% (2,059) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 1853
  FAIL> 206
   END> MakeDb

         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:30:57 |Done                | 0.0 min

PROGRESS> 13:30:58 |####################| 100% (2,059) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 1853
  FAIL> 206
   END> MakeDb

Assigning genes :  75%|███████▌  | 3/4 [01:50<00:39, 39.43s/it]
         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:31:52 |Done                | 0.0 min

PROGRESS> 13:31:54 |####################| 100% (3,222) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 2991
  FAIL> 231
   END> MakeDb

         START> MakeDB
       COMMAND> igblast
  ALIGNER_FILE> filtered_contig_igblast.fmt7
      SEQ_FILE> filtered_contig.fasta
         NPROC> 8
       ASIS_ID> False
    ASIS_CALLS> False
      VALIDATE> strict
      EXTENDED> True
INFER_JUNCTION> False

PROGRESS> 13:31:54 |Done                | 0.0 min

PROGRESS> 13:31:56 |####################| 100% (3,222) 0.0 min

OUTPUT> filtered_contig_igblast_db-pass.tsv
  PASS> 2991
  FAIL> 231
   END> MakeDb

Assigning genes : 100%|██████████| 4/4 [02:49<00:00, 42.45s/it]

Note

If you did not set a path to the igblast or germline paths in the environment above, you need to specify the path to the folders containing the fasta files directly.

ddl.pp.reannotate_genes(samples,
    igblast_db="database/igblast/",
    germline="database/germlines/imgt/human/vdj/")

Step 3 : Reassigning heavy chain V gene alleles (optional but recommended)

Next, we use immcantation’s TIgGER [Gadala-Maria2015] method to reassign allelic calls for heavy chain V genes with pp.reassign_alleles. As stated in TIgGER’s website and manuscript, ‘TIgGER is a computational method that significantly improves V(D)J allele assignments by first determining the complete set of gene segments carried by an individual (including novel alleles) from V(D)J-rearrange sequences. TIgGER can then infer a subject’s genotype from these sequences, and use this genotype to correct the initial V(D)J allele assignments.’

This may impact on how contigs are chosen for finding clones later. It is also important when considering to do mutational analysis. For convenience, germline sequences are reconstructed at this step using the corrected V-gene alleles. Therefore, it is highly recommended to run it.

However, this will only work properly if there is sufficient contigs. An ideal scenario would be to run it on multiple samples from the same subject to allow for more information to be used to confidently assign a genotyped v_call. In this tutorial, I’m assuming the four samples can be split into two sets where sets of two corresponds to a different/single individual. So while important, this step can be skipped if you don’t have enough data to do this.

pp.reassign_alleles requires the combined_folder option to be specified so that a merged/concatenated file can be produced for running TIgGER.

[5]:
# reassigning alleles on the first set of samples
ddl.pp.reassign_alleles(
    samples[:2], combined_folder="tutorial_scgp1", filename_prefix="filtered"
)
Processing data file(s) :   0%|          | 0/2 [00:00<?, ?it/s]
  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IGH
  REGEX> True

PROGRESS> 13:32:03 |####################| 100% (185) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_heavy_parse-select.tsv
  RECORDS> 185
 SELECTED> 89
DISCARDED> 96
      END> ParseDb

Processing data file(s) :  50%|█████     | 1/2 [00:00<00:00,  1.49it/s]
  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IG[LK]
  REGEX> True

PROGRESS> 13:32:03 |####################| 100% (185) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_light_parse-select.tsv
  RECORDS> 185
 SELECTED> 96
DISCARDED> 89
      END> ParseDb

  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IGH
  REGEX> True

PROGRESS> 13:32:03 |####################| 100% (2,413) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_heavy_parse-select.tsv
  RECORDS> 2413
 SELECTED> 1135
DISCARDED> 1278
      END> ParseDb

Processing data file(s) : 100%|██████████| 2/2 [00:01<00:00,  1.37it/s]
  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IG[LK]
  REGEX> True

PROGRESS> 13:32:04 |####################| 100% (2,413) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_light_parse-select.tsv
  RECORDS> 2413
 SELECTED> 1278
DISCARDED> 1135
      END> ParseDb

      Reassigning alleles

Error in findNovelAlleles(db, germline_db = igv, v_call = v_call, j_call = j_call,  :
  Not enough sample sequences were assigned to any germline:
  (1) germline_min is too large or
  (2) sequences names don't match germlines.
Execution halted
ERROR> Database file /Users/uqztuong/Documents/GitHub/dandelion/docs/notebooks/base/dandelion_tutorial/tutorial_scgp1/tutorial_scgp1_heavy_igblast_db-pass_genotyped.tsv does not exist.

      Reassigning alleles
Reverting 18 sequence(s) whose V gene family is absent from the inferred genotype.
null device
          1
     START> CreateGermlines
      FILE> tutorial_scgp1_heavy_igblast_db-pass_genotyped.tsv
GERM_TYPES> dmask
 SEQ_FIELD> sequence_alignment
   V_FIELD> v_call_genotyped
   D_FIELD> d_call
   J_FIELD> j_call
    CLONED> False

PROGRESS> 13:32:22 |####################| 100% (1,224) 0.0 min

 OUTPUT> tutorial_scgp1_heavy_igblast_db-pass_genotyped_germ-pass.tsv
RECORDS> 1224
   PASS> 1205
   FAIL> 19
    END> CreateGermlines

     START> CreateGermlines
      FILE> tutorial_scgp1_light_igblast_db-pass.tsv
GERM_TYPES> dmask
 SEQ_FIELD> sequence_alignment
   V_FIELD> v_call
   D_FIELD> d_call
   J_FIELD> j_call
    CLONED> False

PROGRESS> 13:32:24 |####################| 100% (1,374) 0.0 min

 OUTPUT> tutorial_scgp1_light_igblast_db-pass_germ-pass.tsv
RECORDS> 1374
   PASS> 1374
   FAIL> 0
    END> CreateGermlines

../../_images/notebooks_base_1_dandelion_preprocessing-10x_data_12_10.png
Writing out to individual folders : 100%|██████████| 2/2 [00:00<00:00,  3.78it/s]
[6]:
# reassigning alleles on the second set of samples
ddl.pp.reassign_alleles(
    samples[2:], combined_folder="tutorial_scgp2", filename_prefix="filtered"
)
Processing data file(s) :   0%|          | 0/2 [00:00<?, ?it/s]
  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IGH
  REGEX> True

PROGRESS> 13:32:26 |####################| 100% (1,853) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_heavy_parse-select.tsv
  RECORDS> 1853
 SELECTED> 837
DISCARDED> 1016
      END> ParseDb

Processing data file(s) :  50%|█████     | 1/2 [00:00<00:00,  1.23it/s]
  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IG[LK]
  REGEX> True

PROGRESS> 13:32:26 |####################| 100% (1,853) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_light_parse-select.tsv
  RECORDS> 1853
 SELECTED> 1016
DISCARDED> 837
      END> ParseDb

  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IGH
  REGEX> True

PROGRESS> 13:32:27 |####################| 100% (2,991) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_heavy_parse-select.tsv
  RECORDS> 2991
 SELECTED> 1332
DISCARDED> 1659
      END> ParseDb

Processing data file(s) : 100%|██████████| 2/2 [00:01<00:00,  1.18it/s]
  START> ParseDb
COMMAND> select
   FILE> filtered_contig_igblast_db-pass.tsv
 FIELDS> locus
 VALUES> IG[LK]
  REGEX> True

PROGRESS> 13:32:27 |####################| 100% (2,991) 0.0 min

   OUTPUT> filtered_contig_igblast_db-pass_light_parse-select.tsv
  RECORDS> 2991
 SELECTED> 1659
DISCARDED> 1332
      END> ParseDb

      Reassigning alleles

Reverting 65 sequence(s) whose V gene family is absent from the inferred genotype.
null device
          1
     START> CreateGermlines
      FILE> tutorial_scgp2_heavy_igblast_db-pass_genotyped.tsv
GERM_TYPES> dmask
 SEQ_FIELD> sequence_alignment
   V_FIELD> v_call_genotyped
   D_FIELD> d_call
   J_FIELD> j_call
    CLONED> False

PROGRESS> 13:32:46 |####################| 100% (2,169) 0.0 min

 OUTPUT> tutorial_scgp2_heavy_igblast_db-pass_genotyped_germ-pass.tsv
RECORDS> 2169
   PASS> 2131
   FAIL> 38
    END> CreateGermlines

     START> CreateGermlines
      FILE> tutorial_scgp2_light_igblast_db-pass.tsv
GERM_TYPES> dmask
 SEQ_FIELD> sequence_alignment
   V_FIELD> v_call
   D_FIELD> d_call
   J_FIELD> j_call
    CLONED> False

PROGRESS> 13:32:48 |####################| 100% (2,675) 0.0 min

 OUTPUT> tutorial_scgp2_light_igblast_db-pass_germ-pass.tsv
RECORDS> 2675
   PASS> 2675
   FAIL> 0
    END> CreateGermlines

../../_images/notebooks_base_1_dandelion_preprocessing-10x_data_13_8.png
Writing out to individual folders : 100%|██████████| 2/2 [00:00<00:00,  2.22it/s]

We can see that most of the original ambiguous V calls have now been corrected and only a few remain.

Note

Similar to above, if you you can specify the path to the folder containing the fasta files accordingly:

ddl.pp.reassign_alleles(samples[2:], combined_folder='tutorial_scgp2', germline="database/germlines/imgt/human/vdj", filename_prefix="filtered")

Step 4: Assigning constant region calls

Cell Ranger’s annotation files provides a c_gene column, but rather than simply relying on Cell Ranger’s annotation, it is common to use immcantation-presto’s MaskPrimers.py with a custom primer list.

As an alternative, dandelion includes a pre-processing function, pp.assign_isotypes, to use blastn to annotate constant region calls for all contigs and retrieves the call, merging it with the tsv files. This function will overwrite the output from previous steps and add a c_call column at the end, or replace the existing column if it already exists. The Cell Ranger calls are returned as c_call_10x.

Further, to deal with incorrect constant gene calls due to insufficient length, a pairwise alignment will be run against curated sequences that were deemed to be highly specific in distinguishing IGHA1 vs IGHA2, and IGHG1 to IGHG4. I have also curated sets of sequences that should help deal with IGLC3/6/7 as these are problematic too. If there is insufficient info, the c_call will be returned as a combination of the most aligned sets of sequences. Because of how similar the lambda light chains are, extremely ambiguous calls (only able to map to a common sequence across the light chains) will be returned as IGLC. This typically occurs when the constant sequence is very short. Those that have equal alignment scores between IGLC3/6/7 sequences and the common sequence will be returned as a concatenated call; for example, a contig initially annotated as IGLC3 will be returned as IGLC,IGLC3.

Note

The curated sequences can be updated/replaced with a dict-of-dict-of-dict style dictionary via the option correction_dict. The provided dictionary should be a nested dictionary like the following:

primer_dict = {
    'IGHG':{
        'IGHG1':'GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCCAAGAGCACCTCTGGGGGCACAGCGGCCCTGGGC',
        'IGHG2':'GCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCGGCCCTGGGC',
        'IGHG3':'GCTTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCTGGGGGCACAGCGGCCCTGGGC',
        'IGHG4':'GCTTCCACCAAGGGCCCATCCGTCTTCCCCCTGGCGCCCTGCTCCAGGAGCACCTCCGAGAGCACAGCCGCCCTGGGC'}}

The key for the first level of the dictionary is used for searching whether the string pattern exists in the c_call, and the second level holds the dictionary for the the reference sequences to align to. The keys in the second level are used for replacing the existing c_call annotation if it is returned with the highest alignment score. The function currently only accepts 2-4 reference sequences for the pairwise alignment.

[7]:
ddl.pp.assign_isotypes(samples, filename_prefix="filtered")
../../_images/notebooks_base_1_dandelion_preprocessing-10x_data_16_0.png
/Users/uqztuong/Documents/GitHub/dandelion/src/dandelion/base/preprocessing/_preprocessing.py:4306: FutureWarning: DataFrameGroupBy.apply operated on the grouping columns. This behavior is deprecated, and in a future version of pandas the grouping columns will be excluded from the operation. Either pass `include_groups=False` to exclude the groupings or explicitly select the grouping columns after groupby to silence this warning.
/Users/uqztuong/Documents/GitHub/dandelion/src/dandelion/base/preprocessing/_preprocessing.py:4521: FutureWarning: Downcasting behavior in `replace` is deprecated and will be removed in a future version. To retain the old behavior, explicitly call `result.infer_objects(copy=False)`. To opt-in to the future behavior, set `pd.set_option('future.no_silent_downcasting', True)`
../../_images/notebooks_base_1_dandelion_preprocessing-10x_data_16_2.png
/Users/uqztuong/Documents/GitHub/dandelion/src/dandelion/base/preprocessing/_preprocessing.py:4306: FutureWarning: DataFrameGroupBy.apply operated on the grouping columns. This behavior is deprecated, and in a future version of pandas the grouping columns will be excluded from the operation. Either pass `include_groups=False` to exclude the groupings or explicitly select the grouping columns after groupby to silence this warning.
../../_images/notebooks_base_1_dandelion_preprocessing-10x_data_16_4.png
/Users/uqztuong/Documents/GitHub/dandelion/src/dandelion/base/preprocessing/_preprocessing.py:4306: FutureWarning: DataFrameGroupBy.apply operated on the grouping columns. This behavior is deprecated, and in a future version of pandas the grouping columns will be excluded from the operation. Either pass `include_groups=False` to exclude the groupings or explicitly select the grouping columns after groupby to silence this warning.
../../_images/notebooks_base_1_dandelion_preprocessing-10x_data_16_6.png
/Users/uqztuong/Documents/GitHub/dandelion/src/dandelion/base/preprocessing/_preprocessing.py:4306: FutureWarning: DataFrameGroupBy.apply operated on the grouping columns. This behavior is deprecated, and in a future version of pandas the grouping columns will be excluded from the operation. Either pass `include_groups=False` to exclude the groupings or explicitly select the grouping columns after groupby to silence this warning.

Note

Should you want to use a different reference fasta file for this step, run with the following option:

ddl.pp.assign_isotypes(samples, blastdb="path/to/custom_BCR_constant.fasta")

The default option will return a summary plot that can be disabled with plot=False.

Finally, it’s worthwhile to manually check the the sequences for constant calls returned as IGHA1-2, IGHG1-4 and the light chains and manually correct them if necessary.

Step 5: Quantify mutations (optional).

At this stage, with all the necessary columns in the files, you can quantify the basic mutational load with pp.quantify_mutations, a wrapper of SHaZaM’s basic mutational analysis in R [Gupta2015], before subsequent analyses. This will be covered again later in the Calculating diversity and mutation section.

[8]:
from tqdm import tqdm

# quantify mutations
for s in tqdm(samples, desc="Basic mutational load analysis "):
    filePath = s + "/dandelion/filtered_contig_dandelion.tsv"
    ddl.pp.quantify_mutations(filePath)
    # or dandelion.external.immcantation.shazam.quantify_mutations(filePath)
Basic mutational load analysis : 100%|██████████| 4/4 [00:19<00:00,  4.98s/it]